Example Of A Formative Essay. Online assignment writing service.
1. Example Of A Formative Essay
1. Step
To get started, you must first create an account on site HelpWriting.net.
The registration process is quick and simple, taking just a few moments.
During this process, you will need to provide a password and a valid
email address.
2. Step
In order to create a "Write My Paper For Me" request, simply complete
the 10-minute order form. Provide the necessary instructions, preferred
sources, and deadline. If you want the writer to imitate your writing
style, attach a sample of your previous work.
3. Step
When seeking assignment writing help fromHelpWriting.net, our
platform utilizes a bidding system. Review bids from our writers for
your request, choose one of them based on qualifications, order history,
and feedback, then place a deposit to start the assignment writing.
4. Step
After receiving your paper, take a few moments to ensure it meets your
expectations. If you're pleased with the result, authorize payment for the
writer. Don't forget that we provide free revisions for our writing
services.
5. Step
When you opt to write an assignment online with us, you can request
multiple revisions to ensure your satisfaction. We stand by our promise to
provide original, high-quality content - if plagiarized, we offer a full
refund. Choose us confidently, knowing that your needs will be fully
met.
Example Of A Formative EssayExample Of A Formative Essay
2. Essay On Spss
Static: The statistics was applied by means of SPSS software (SPSS ver. 16, Inc., Chicago, IL).
T test was used for each group at a significant value at ps cells, with the highest levels found in
the cells of the heart, liver, muscles, kidneys, lungs, and in blood cells; bacteria also produce
LD. This test measures the level of LD in the blood or sometimes other body fluids. Only a small
amount of LD is ordinary detectable in the fluid portion of the blood (serum or plasma). LD is
produce from the cells into the serum when cells are breached down., it may be used, in
incorporation with other blood tests, to help controlling cases that lead to tissue damage, such as
liver or blood diseases or cancer. In this study, we used high... Show more content on
Helpwriting.net ...
Neutrophils encounter and kill microbes intracellular upon phagocytosis when antimicrobial
granules fuse with the phagosome furthermore release lytic enzymes and reactive oxygen species
(ROS) that destroy pathogen. Brucella doesn t replicate within neutrophils Skendros Boora. Our
study pointed to there is no significant change between healthy and infected group in TNF О±
concentration because cell death by members of TNFR occurs by apoptotic cell , unique feature
of apoptin cells is that they retain cell membrane integrity even after they have disintegrated into
characteristic apoptotic bodies .Apoptotic cells and bodies are phagocytized by active
macrophages, thus preventing inflammatory reaction that can result from cell lysis this result
came agree with( Ming Li and Amer 2000) (Baldwinet.al 2006 , Baldwin et.al.2005 Martirosyan
et.al.2011 ) who recorded that Brucella inhibit host cell apoptosis to produce favoring bacterial
survival by escaping from host immune surveillance when cells dying by necrosis can lead to
inflammation because Brucella alter the maturation and function of DCs (critical component of
adaptive immunity) prevent infected cell from engaging in their maturation process , impair
capacities and failed to release TNF. Jianhua pie et. Al 2008 added that tumor necrotic factor (TNF
О±) is cytotoxic for many humoral cell lines, whereas normal cells generally are considered
resistant to this
... Get more on HelpWriting.net ...
3. Voter Turnout Research Paper
Elections are an important part of creating a legitimate state. They allow us to have a say in how
decisions are made in a government. However, the voter turnout for an election does not have an
effect on the type of regime that will develop in a state. It does not matter if the election is in an
authoritarian government or a democratic one, the regime does not have a large impact on the
turnout of voters. What matters in voter turnoutis whether the citizens believe in the regime. If they
feel that the state is legitimate then they are more likely to vote. Also, if the voters believe that
their vote counts and is not a wasted vote then you are more likely to have a larger voter turnout.
For example, the International Institute for Democracy
... Get more on HelpWriting.net ...
4. Allochthon Hypothesis
From the above section we already talked about the rocks of Roberts mountains allochthon and
autochthon. In this section, we are trying to evaluate the Roberts mountains allochthon and
autochthon according to the Mediterranean analog hypothesis proposed by Burchfield and Royden
(1991), and modified by Dickinson (2000) rather than island arc collision hypothesis. Burchfield
and Royden (1991) cast doubted the island arc collision hypothesis because: 1. the arc west of the
North American continent and its structures seem more to face west rather than east. 2. The
Havallah basin sediments deposited before and after the emplacement of the Roberts mountains
allochthon. 3. Deposition occurred in a paleogeographic location that should have been occupied...
Show more content on Helpwriting.net ...
In the east facing subduction zone, a thrust belt developed as an accretionary prism, and the trench
retreated within the subduction zone (slab rollback) caused the thrust to migrate toward the
continental margin. As a result, Havallah basin formed within an enlarging extensional region to
the west of the trench and thrust belt. So how does slab rollback work? The slab rollback occurs
when an older oceanic crust, which may lose heat by thermal contraction or another reason; thus
becomes colder and denser than other slabs, then subducting at a steep angle. The slab rollback may
pull the upper plate, as the colder slab collapses into the asthenosphere; it can roll back through the
mantle. As a result it causes an extension in the overlying plate (example an enlarged extensional
region in the Havallah basin) and possibly backarc spreading. Havallah sedimentation began during
the emplacement of the allochthon, in an extending region to the west. Low grade rocks formed in
the Osgood Mountains were exposed by tectonic unroofing during extension and unconformably
overlain by post tectonic Pennsylvanian sedimentary rocks. In the hanging wall of the antler
subduction system, arc volcanic that may have been erupted near or within the backarc extension,
were extended and subside during or shortly after
... Get more on HelpWriting.net ...
5. Nt1310 Unit 8
1.What does the vertical axis represent? The vertical axis represents the voltage scale. (how
many volt or amp per division). 2.What does the horizontal axis represent? The Horizontal axis
represents the Time scale. (the sweep speed). 3.Altering time physically changes the horizontal
axis how? It will increase or decrease each division to the choosing time which will change the
horizontal axis per screen. 4. When using an amp clamp, what type of reading (volts, amps,
ohms) appears on the vertical axis? Explain the basic process the scope uses to obtain this type of
reading. With an amp clamp amps appear on the vertical axis. The scope obtains this type of
reading from the magnitude of AC and additionally the phase and waveform can also be... Show
more content on Helpwriting.net ...
What feature may be utilized to see specific detail of an event and may also be useful for
observing intermittent issues? The reduced rearm delay which is provided by digital triggering,
together with segmented memory allows the capture of events that happen in rapid sequence.
Rapid triggering can capture a new waveform every microsecond until the buffer is full. 6. A
repeat trigger is being used to read a pattern. After the trigger is moved on the screen, the pattern
disappears. What is the most likely problem? The most likely problem for the reason the info
(pattern) disappears is that your readings are out of parameters that you have set it to. 7. What is
the advantage of using the repeat mode for a trigger vs. the automatic mode? The advantage of
using Auto mode is that when you re looking at your wavelength and readings, they are
consistent. If at any time the readings go out of parameters it will still display the readings. If
this was to happen in Repeat mode... where your readings go out of parameters the data would
simply not be there it would be a blank reading on the screen. 8. What is the term used to
describe number of frames recorded. The term used to describe the 1 1000 frames recorded is
called a your Complete Record. 9. A high sample rate does what to the
... Get more on HelpWriting.net ...
6. Closing The Gap In Your Teeth Essay
Why Veneers Are A Good Option For Closing The Gap In Your Front Teeth
If you have a gap between your front teeth, you might be embarrassed to show your smile. There
is nothing wrong with having a gap in your teeth as long as it s natural and not caused by gum
disease. It doesn t need to be fixed unless it makes you feel self conscious. To close the gap, your
dentist will either move your teeth closer together with braces or cover it up with a crown or
veneers. Veneers may be your best option. Here s why.
Braces Take A Long Time To Work
It takes braces several months to readjust the position of your teeth. If you don t mind waiting
that long, then braces might be a good choice for you because you ll be able to save the enamel
on your teeth that way. However, braces aren t always practical for adults, even the invisible
variety, especially if you have an occupation where your looks are very important. Plus, braces are
expensive. While they work, there is a ... Show more content on Helpwriting.net ...
The veneers can be made any size, shape, and color needed to correct the appearance of your smile.
In the case of a gap, your dentist applies a veneer on the tooth on each side of the gap. The veneers
are a little wider than your natural teeth, so when they are in place the gap disappears. It only
takes a couple of weeks to go through the process of getting this dental procedure.
First, your dentist makes an impression of your teeth so a dental lab can make the shells to fit
in your mouth precisely. It will take a couple of weeks to get your custom veneers back from the
lab so your dentist can apply them. To get the veneers to fit properly in your mouth, your dentist
needs to shave off a very thin layer of tooth enamel. Then the veneers are bonded into place with
dental cement. The process works much quicker than braces, which is important if you decide you
want the cosmetic work done in time for a wedding or big job
... Get more on HelpWriting.net ...
7. Comparing Frankenstein And Gothic Literature
Brianna Cairon
Mrs. Schroder
Honors English IV
8 December 2016
Frankenstein and Gothic Literature To define gothic literature, someone might state that this genre
includes mystery and horror in writing with characters fighting for power over one another. The
stories written in this way typically include strange and mysterious locations that characters find
themselves in as well as horrific situations. The plot might include threatening and dangerous
circumstances that evoke fear out of the readers themselves. After comparing a definition of gothic
literature to the story Frankenstein, the plot aligns perfectly with the explanation.
The introduction to the frame story in the novel begins in the letters and here, gothic characteristics
that ... Show more content on Helpwriting.net ...
Ingolstadt represents the unknown in certain ways. For example, it is the place that doctor
Frankenstein spends most his young adulthood studying and creating the creature. This place is
where the most horrific situations begin including the abandonment of his family, search for
knowledge, and creation of the most dangerous human like being. In contrast, Geneva represents
some sort of safe haven for doctor Frankenstein. In the beginning of the novel, this location is
where he grew up and had a fairly normal childhood. In contrast, it is where he flees to forget
about his blunder and removes himself from the depressing situation. Inevitably, Geneva
transforms into a dark place after the murder of Frankenstein s youngest brother. This once again
shows the mystery side of the story, and readers could only wonder if the ugly creature had
anything to do with it. Likewise, the forest the organism spends his time in after his
abandonment shows similar characteristics of mystery, but differs by adding the aspect of
loneliness. The creature could never understand why the majority of people were afraid of him
and shamed him. Therefore, he decides to reside in a cold and lonely forest, living in a small
hut. Eventually, Frankenstein finds his creature in these woods and they meet again and discuss
the life he has lived, observing the family that lives by him, learning and developing language
and social skills, and trying to survive. Here, doctor Frankenstein begins to truly understand what
he had created and he realizes that this creature only longed for love and to be loved after his
struggle to fit in. But once the creature was aware of his inability to be normal and live his life as
a regular human, his desire to be loved transformed into anger and resentment towards
... Get more on HelpWriting.net ...
8. Examples Of Wisdom In The Iliad
Wisdom Younger men are changeable; he in his age among them, looking before and after, can
see clearly, what shall be in the interests of all. (Homer 65) This is what Menelaos, Helen s
husband and king of the Mycenaeans, addressed his army with in Book Three of the Iliad by
Homer. I disagreed with Menelaos and what he told his army. First, whether one is young or old,
everyone changes one s mind. For example, throughout the Iliad we can see that Zeus, king of the
gods, changes his mind on whether or not the gods can help in the Trojan War between the
Greeks and the Trojans. At the beginning of Book Eight, Zeus addresses the gods saying, If I
catch sight of anyone slipping away with a mind to assist the (Greeks) or the Trojans, he comes
back blasted without ceremony, or else he will be flung out of Olympos into the murk of Tartaros
that lies deep down in underworld, but then he turns around and starts interfering with the... Show
more content on Helpwriting.net ...
Zeus, despite having years of wisdom from his many years of life, changes his mind on whether
the gods can interfere with the war. This example proves that even if one is old one can still
change one s mind. Second, wisdom, by the world s standpoint, is not based off of age, but off
of cognition among other qualities. Vivian Clayton, a neuropsychologist, did a study in the 1970
s on wisdom. After asking retired judges and law students and professors, who would have all
been considered wise, she concluded that wisdom is based off of the cognition, compassion, and
reflection of a person. Monika Ardelt, an associate of Vivian Clayton, then proceeded to test other
people asking them questions based on cognition, compassion, and reflection. She found that her
older subjects had less cognition than her younger subjects. These experiments and studies show
that wisdom, from the world s view, is based off of cognition, among other qualities, not age.
Finally, one does not have to be old to achieve
... Get more on HelpWriting.net ...
9. The Rev. Charles Richard
The Rev. Charles Richard became the third pastor of the parish in 1895, coming to Sacred Heart
from Gibson, Louisiana. He was a familiar figure riding on horseback on one of his three horses,
Fanny, Dolly and Charley, as he traveled through the parish. The French Canadian Richard
offered all the services in French, although he did present some of the homilies in English
beginning in 1906 . On March 23, 1896, the Francois Viguerie property was transferred to Sacred
Heart of Jesus Church. The property was one arpent (608.46) linear feet wide to the point of the
survey which was interpreted to be the 40 arpent line. The recorded deed is in the Terrebonne Parish
Conveyances book as Deed 455. A second piece of property was received from Albert R.
Viguerie on December 17, 1897. [insert picture of Prompt Succor] On December 17, 1897, on
behalf of Sacred Heart, Rev. Richard received a donation from Joseph Oleus Duplantis, Joseph
Bussy Duplantis, Israel Duplantis, Theophile Duplantis, Meleo Duplantis, and Joseph Augustine
Duplantis (the heirs of Marie Susanne Duplantis Jolet for a tract of land on Upper Little Caillou
(RR Folio 276, Donation Book, A folio, 149) , and built a chapel dedicated to Our Lady of
Prompt Succor. The property was bounded above by the property of Alexis Duplantis. The Prompt
Succor bell was cast in 1901 by the Buckeye Bell Foundry, The E.W. Vanduzen Co of Cincinnati,
Ohio. The bell, named Angelus was placed in the steeple of the church, but in
... Get more on HelpWriting.net ...
10. Banning Pitbulls
Euthanizing banned dogs
Dog lovers and the public have been raving about a topic that has gone viral and is soon to be on
the rise: painless putting band dogs down. It is believed by many around the world that these
animals are vicious, and aggressive by nature. By reason and choice I also believe aggressive pit
bulls and other banned breed dogs should be destroyed by euthanasia, and any further breeding
should be terminated. These specific breeds of dogs are very unpredictable, and are seen to
have an aggressive nature. They also leave a long line of countless and unnecessary deaths in its
wake. Some argue if these dogs cease to exist altogether then there would be no problems, as
they would just be replaced by less vicious dogs. Many people would argue Pit bulls and other
banned dogs are always only as good as the environment they are raised in, and the kind of stress
they are put under.
Pitt bulls and other banned dogs are known to be unpredictable, even to their own owners. It is
common for most attacks to be against another ... Show more content on Helpwriting.net ...
For some, They getaway with just a few ghastly scratcches, but others arent so lucky.In a recent
11 year period, from 2005 to 2015, pit bulls killed 232 Americans, about one citizen every 17
days.14 By 2018, pit bulls are projected to have mauled to death 338 Americans since 1998, the
year the CDC stopped tracking fatal dog attacks by breed, and over 415 people since 1980 google.
Many victims of these attacks aren t fortunate enough to come back with their lives, and those who
do can often have deformed body parts. Victims of severe dog attacks often suffer acute damage,
which may require $250,000 to one million dollars in specialized medical care treatment.
Reconstructive surgery, such as skin grafts, tissue expansion and scar diminishment, often requires
multiple procedures over a period of years
... Get more on HelpWriting.net ...
11. The Identity Status Of Individuals Essay
Yet, when looking at the identity status of individuals, the significant link between NSSI and
identity once again emerges suggesting that is more important as to what identity status an
individual has achieved (Luyckx et al, 2015b). Furthermore, in this same study, Luyckx et al
(2015b) found that individuals who were currently in moratorium were more likely to have
engaged in NSSI in the past, but not the present. This may suggest that NSSI is related to identity
crisis and the inability of an individual to obtain identity synthesis in adolescence (Luyckx et al,
2015b). Moreover, the researchers found that individuals in achievement indicated significantly less
engagement in NSSI behaviors than the other identity statuses. Additionally, individuals who were
currently in the troubled diffusion status were most likely to be engaging in NSSI at the present
time. This suggests as some of the other studies have suggested that identity confusion is related
to NSSI (Luyckx et al, 2015b). However, NSSI was not shown to be significantly correlated with
the carefree diffusion status which may be due to the individual s disinterest in identity issues
(Luyckx et al, 2015b). When examining the impact of different domains of identity formation in
relation to NSSI, gender differences emerge (Gandhi, Luyckx, Maitra, Claes, 2015). Distress
related to interpersonal domains such as career and friendship evoked more distress in females than
in males. Yet, both males and females
... Get more on HelpWriting.net ...
12. The Hypocritical Analysis Of The Canterbury Tales
In The Canterbury Tales, Chaucer illuminates the nefarious behavior by the nobility and clergy
through the satire of the discourse between their stated ideals and their actions. Chaucer exposes all
of his characters to reveal their true temperament and intentions. The characters that are criticized
are ones who manipulate those around them for personal gain or are the most hypocritical. Chaucer
has the greatest problem with the Catholic churchand their unethical means of obtaining money
but he has problems with every spoke on the wheel, which is the estate system. Chaucer uses the
Pardoner as a portrayal of the church s corruption and inappropriate infatuation with wealth. He
sees the church as fraudulent in the respect that they sell entry into heaven by way of
indulgences. The Pardoner openly admits his fraudulent sale of relics, while feeling no
remorse. He fully accepts his hypocrisy, even embracing it as he says to the other pilgrims, And
thanne my bulles shewe I, alle and some / Oure lige lordes seel on my patente / That shewe I
first, my body to warente / That no man be so boold, ne preest ne clerk / Me to destourbe of
Cristes hooly werk (260). This deception that the Pardoner partakes in is what Chaucer finds issue
with. Due to the open hypocrisy of the Pardoner the question is posed; is open hypocrisy any better
than closed? Chaucer believes that it is no better for the Pardoner to admit his shortcomings and
accept them, because he refuses to change his wicked
... Get more on HelpWriting.net ...
13. Hans Holbein, the Ambassadors
Hans Holbein The Ambassadors #10086;Introduction The Ambassadors is one of the most complex
and arguably portrait which Holbein had painted. The purpose of this report is to analyze Han
HolbeinВЃfs painting, ВЃgThe AmbassadorsВЃh. The main task of this report is to uncover the
meaning of this painting, as it still remains unclear. Firstly, I will give a short introduction about the
painter. Then, I will examine the characteristics of the people and the objects in the painting. Lastly,
I will attempt to identify the meaning of the painting. #10086;About Han Holbein Hans Holbein the
younger was a German artist born in Augsburg, Bavaria. He was an outstanding portrait and
religious painter and his works ranges from woodcuts,... Show more content on Helpwriting.net ...
What does the distorted skull mean? According to the analysis of some experts, this skull added
to the Ambassadors marks the artist s consistent vision of the frailty of human destiny. Others
think that it might not hold any meaning to it. Holbein has used mathematics to draw the skull by
a process called anamorphic projection. Maybe the skull was added just because Holbein wanted
to show off his skills because intense calculations are needed to create such effects. Other than the
skull on the foreground, there is another skull hidden in the band of Jean de Dinteville s cap and a
crucifix hidden behind the green curtain on the far left of the painting. It still remains unclear that
why these two skulls and the crucifix are placed in the painting. #10086;Conclusion Lastly, after
much observation, I think this painting has close relations with Religion and Death. The Crucifix
and the Skull known as symbol of death suggests how death is inevitable for human beings. It
indicates the hidden yet truthful realization of human mortality. Whilst the ambassadors stand there
proudly amid their tools of knowledge, death is constantly there. No matter how advance science
is, death is inevitable. I am sure Holbein painted the Crucifix for a reason. Maybe he is trying to
indicate that people are so overwhelm by the progress of science that they start to forget about the
importance of
... Get more on HelpWriting.net ...
14. The Importance Of Energy
Energy is a crucial necessity in life for humans and wildlife. Quality of life is dependent on our
accessibility of energy. The environmental crisis has been felt by everyone in some way. The need
for energy continues to increase as the population grows. Relying on past resources for energy will
continue to torment the environment and negatively impact the level of supply. Energy is a
resource that can be depleted if the abuse continues. Pollution from energy sources has caused the
environment to deteriorate. The negative influences from energy sources has caused health
problems, loss of wildlife and abuse of other resources. In order to protect public health and the
future of the environment, preventable measures must be taken.
Energy is used for everything we do in life. The two types of energy sources are renewable and
nonrenewable. Nonrenewable energy is a source that cannot be used again because it does not
renew itself. Renewable energy is a source that can be used again because it can be replenished.
There are different sources available for each type of energy. Each resource has its own advantages
and disadvantages. Each source has economic and ecological impacts that need to be evaluated.
More than 80% of energy in the US comes from fossil fuels (Eia). Fossil fuel is the world s primary
energy source (Eia). Fossil fuels are used for transportation, heating and electricity. Natural gas is
used for electricity and heating homes and buildings. Coal is used to generate
... Get more on HelpWriting.net ...
15. The Scene I Of Act IIi
Throughout the evolution of a theme and seven variations as well as a two part fugue, Berg
explores the possibilities of various numeric significances and an ever evolving harmonic and
melodic vocabulary. By presenting the audience with a familiar formal structure Berg is then
free to more openly manipulate and change other variables such as using non functional
harmonies and unresolved melodic passages. He combines both dramatic and musical
foreshadowing to create a visual and aural experience for the listener that is while always being
conscious with what would be too overwhelming to the audience. Berg creates an opera ripe with
symbolism and significance. The introspective Scene I of Act III is no exception. The scene
opens with Marie in her continued struggle through life, attempting to find solace in her bible.
The audience is presented with her frantic behavior in this scene and further observes how the
plot will finally unfold, a sad and unfortunate end. Musically, Berg paints this surrealism
wonderfully, and through his recurring methods and musical vocabulary, ties the scene together.
Following two bars of silence, the scene opens with a descending fourth figure that gradually
evolves into an ascending third figure in m.6. The four opening notes of the scene, G D F Eb,
form a 0146, which is an all interval tetrachord. On top of this linear tetrachord a solo cello
oscillates between the notes G and D. These pitches are the tonic and dominant of the initial key
area
... Get more on HelpWriting.net ...
16. Theories Of Health Related Behaviour
This theory is one of the first theory that emerged in solving health related behaviour. It attempts to
anticipate and explain the behavioural effects on an individual s health. The theory is driven by the
attitude and the beliefs of the individuals. HBM is a good model to for informing people about the
negative consequences of health related behaviour.
The idea is that someone will be very adamant to take an health related action if they realise and
perceive the negative impact of their behaviour. In the case of Harry, he has perceived that his
smoking habit has began to have a negative consequence on his health. The symptom of heartburn
has been troubling him recently. Now that Harry perceives the negative consequences of smoking,
his attitude ... Show more content on Helpwriting.net ...
For example, Harry knows that a positive evaluation of quitting smoking will be that his health
will improve and he will not be at risk of suffering from some major health conditions. A negative
attitude to this is that, Harry is aware that smoking costs him money. He smokes an average of 20
cigarettes a day. Smoking average cost ВЈ6 per pack. If continues smoking, he will would have
spent an average of ВЈ2,190 in a year (Nhs.uk,
... Get more on HelpWriting.net ...
17. Joseph
The story of a young brother that unleashed anger, envy, annoyance , and rivalry in his own
family. He was the eldest son of Jacob and Rachel, the product of true love. His life faced a
turning point, caused by his father s decisions which later became the reality of being abandoned
by his brothers, sold to the Ishmaelite and being raised in another culture.While It was his father s
and brother s decisions that made Joseph fulfill his destiny in Egypt , Jacobs behavior leads to
conflicts in his family. Joseph is given preference over the rest of his brothers, and he is awarded
with a tunic that makes his father s position towards the rest very clear..The beginning of parental
favoritism, can be traced a few chapters back in the book of... Show more content on
Helpwriting.net ...
It would have been better for the entire family if Jacob would have never given the garment,
because everyone knew already that Joseph had the undivided attention from his father, and the
tunic was not necessary to approve that. Jacob is the one to blame for unleashing the wrath of
his sons towards Joseph. The problem was big enough and there was no need to make it bigger,
which eventually later in the story results in Joseph s exile into Egypt. Most importantly this is a
passage that interestingly shows many family problems that we are currently witnesses of, such
as parents marking their children lives through their decisions which further more have an
outcome in their children future and that parents are not always the best at their job, but they
think they are. This story is important , it shows the traveling periods of human beings , how
obstacles in life can shape a person and be rewarding in the future. It is clear that God, had a plan
for Joseph, since the beginning of the story, we do not know why, but maybe it was Joseph s
attitude overall that honored God. And he is to be truly admired by his faithfulness in the entire
story, he never gave up. His dreams were a vision of the future, and visions that became true, in the
moment he saved his family s
... Get more on HelpWriting.net ...
18. Eassy On Deforestation
Deforestation is a commonly known environmental issue across our world today, yet still has a
long posed threat to our earth. Deforestation is a permanent process of humans removing a forest
or stand of trees where the land is later converted to a non forest use. The forest covers over 30%
of our planets land, and the ecosystems they create are essential for life. Not not only do forests
produce vital oxygen but provides homes and shelter for people and wildlife. Forests provide a
habitat for over 80% of the animals living on land and even for a large majority of humans, who
rely on rainforests for their daily food. In addition they provide protection from flooding and
sandstorms. But, deforestationis utterly diminishing them, at an extremely fast rate. It is estimated
that 4 to 6,000 rainforestspecies go extinct each year.
Deforestation occurs in different places around the world, tropical rainforests however are the most
common and targeted areas. The tropical forests are forests that span both sides of the Equator and
they are the most. They are the most diverse ecosystems on the planet. Brazil has the highest rate in
the world, since 1970 over 600,000 square kilometres of the Amazon Rainforest has been destroyed.
At the current rate of destruction, 100 years from now our forests could completely disappear. In
the Amazon for example, around 20% of the forests have been completely destroyed in the last 50
years, only due to forest conversion for cattle ranching.
In
... Get more on HelpWriting.net ...
19. The Fifth Season Sparknotes
Okay, so this is how this is going to work... The deep book review will be split into different
sections, one where I will dump a bunch of information about the storyline on the reader, another
where I will rant about what makes this book deep but not good, and, finally, another about the
author. The footnotes will be my way of interjecting Laszlo esque commentary on what would
normally be a more formal piece of writing without drastically altering the formality of the review.
Throughout the book, The Fifth Season changes from Syenite to Damaya to, finally, a character
referred to as you (as you might expect, all chapters written from you s perspective are written in
second person). As the book moves on, switching from character to character, similarities between
Syenite and Damaya start to appear, until, chapter seventeen, when it is revealed Damaya is just a
young Syenite. Towards the end, Syenite is revealed to be you (your name is Essun). So all along,
when you thought you were reading the story of three different ... Show more content on
Helpwriting.net ...
The Fifth Season is definitely interesting, however, I sort of enjoyed reading it because of its
complexity, and, as it is part of a series, it has a sequel. This sequel gives you a glimpse into what
is going on with Nassun and helps explain some stuff, namely, what the hell is happening. Well,
Father Earth lost his favorite child, so, in an attempt to appease Father Earth, some of the stone
eaters decided they should try and get his favorite child, the moon back. So, the book ends with
Essun getting ready to catch the moon. Pure awesomeness aside, I feel like I liked it better when
things were confusing. The second book, The Obelisk Gate, doesn t contain as many of the
storyline scrambling mind blowing revelations that made the first one so interesting, so it has to
rely mostly on storyline. This means it is a bit more enjoyable to read, but it doesn t contain any of
the things that, in my mind, make The Fifth Season deep book
... Get more on HelpWriting.net ...
20. Napoleon Perdis
Napoleon Perdis is the creator of a line of women s cosmetics, aptly named after him, allowing
women of all ages the opportunity to enhance their natural beauty and best facial features through a
selection of colour cosmetics. Today, Napoleon Perdis is a respected, international cosmetics brand,
with Napoleon s makeup artistry skills hired for use on fashion shows and film projects, both in
Australia and internationally.
The success of the Napoleon Perdis brand did not happen overnight. Having completed a Political
science degree, majoring in business law and marketing management, and with a $30 000 loan from
his father, Napoleon opened his first cosmetics store and make up Academy in 1995 on Oxford
Street, Paddington. It is through his ... Show more content on Helpwriting.net ...
Napoleon Perdis is perceived to be a very independent person, highly valuing creativity and the
freedom to act, which are stated as characteristics of Self Direction by Alice Ramos (2006). We
can see that Napoleon possesses these qualities through his description of his personality when
establishing his business, I was very aggressive and assertive, and I was very positive with what I
wanted (Spicer 2006). From this information it is clear that Napoleon would consider Self
Direction of high importance. This quote also reinforces the fact that Napoleon has an internal
locus of control, meaning he believes that he is responsible for his own fate.
Because of Napoleon s dynamic and energetic personality, I believe that he would value Stimulation
as of high importance to him, as he seems to enjoy change, excitement and stimulating experiences.
Coming from humble beginnings it is clear that Napoleon intends to enjoy his life and the wealth
that he has created, having not been exposed to many luxuries during his childhood. Because of
his upbringing, I feel that Napoleon would regard Power and Hedonism highly as values, as he
appears to consider power and material possessions of importance. The importance of power to
Napoleon is seen through such comments as I want to be remembered for something (Light 2005),
while the importance he places on personal wealth is seen through his notoriously
... Get more on HelpWriting.net ...
21. Dolby Digital s Sound Analysis
Going to the movies becomes a distant memory when you have the Sony TA 9000ES pre
amplifier in your home theater system. Dolby Digital s sound creates stellar audio and delivers
a near perfect theater experience in your home. The preamp offers customized modes of sounds
depending on the size of your room. This unit allows you to balance the sound perfectly to
enhance the content you are viewing. This sony TA e9000es features an exclusive digital
cinema with virtual, 3D delivery that supports a variety of devices including DVD players, CD
players, and phonographs. Its multi dimensional surround sound and studio mix modes allow it
to give you an immersive listening experience. This Sony TA e9000es has digital and analog
connections for your convenience. There are five audio in and two audio outs. These
connections allow you to connect the Sony TA e9000es with receivers, speakers, and Blu ray
players. Its six video inputs and three video out ports allow for connections with video gaming
systems and other accessories. There are also six s video in and three s video outs for digital
signals. With five optical ins and three optical outs, you can connect every piece of home theater
and listening equipment you have. It also has one RF in for tuner use and 3 coaxials in for
connecting a turntable, tape deck, VCR, or laser disc player. Its other connections include a RS
232c port for use with your other electronics accessories.... Show more content on Helpwriting.net ...
It has a 100 dB input sensitivity. Its output voltage is 50 kOhm. It operates at a frequency
response of 20 to 20,000 Hz at 1 volt and 1 kOhm of impedance. At these specifications, you can
use this Sony with your preferred speakers, receivers, and
... Get more on HelpWriting.net ...
22. President John F. Kennedy And Dr. Martin Luther King Jr.
Former President John F. Kennedy and Dr. Martin Luther King Jr., gave the world two of the
most iconic and historic speech in American history. In January of 1961, John F. Kennedy gave
his infamous Inaugural Address. Not even heavy snow fall could deter JFK s inaugural address.
His mission was to reassure the American citizens their strengths and at the same time, motivate
them to inspired the world. One of the most famous phrases for Kennedy s speech, And so, my
fellow Americans: ask not what your country can do for you ask what you can do for your
country. One the other hand, Dr. Martin Luther King Jr. speech I Have a Dream is a public
speech during the March on Washington for Jobs and Freedom. King was one of the most famous
American civil rights activist. His mission for this iconic speech, was a call for an end to racism in
the United Statesof America. Thus, this speech was a defining moment in the civil rights
movement and was done so, at the Lincoln Memorial. Dr. King was a Baptist minister and was
the driving force behind the civil rights movement. He demanded justice for the unjustly. Mainly
the people of color. Both men, Dr. King and Mr. Kennedy, had some what of the same visions of
America. Their goals for America in their speech demanded peace and prosperity. Kennedy said,
Let every nation know, whether it wishes us well or ill, that we shall pay any price, bear any
burden, meet any hardship, support any friend, oppose any foe, in order to assure the
... Get more on HelpWriting.net ...
23. The 18th Amendment And The Era Of Social Reform
The 18th Amendment was passed in 1918 to prohibit the manufacture, transport and sale of
alcoholic beverages. While it had noble intentions,it produced another entire set of problems for the
country. The amendment itself was repealed in 1933 in an effort to restore order. Why was this
ammendement ever introduced, by whom and what events led to national attention because of it?
With the era of social reform grew the increase in alcohol consumption. It was believed by certain
groups/ people that there was a distinct link between this and the breakdown in family dynamics (
domestic violence, abuse) and the productivity of the workforce. There was strong debate for and
against this ammendement . The Assosociation Against the
... Get more on HelpWriting.net ...
24. Individuals Harsh On Others
In this planet we live in, individuals are only uneasy with things that go against them. John Doe,
a learner at a school had an educator which fits the past explanation. That is in light of the fact
that if anything individuals can help stammers with, it might be quietness. Individuals are losing
persistence for little things that needn t any power to get them through. Numerous illustrations
in history have been recorded, however I speculate individuals are not gaining experience from
samples. A case that matches the uneasy tolerance with things is with stammers. This case is
extremely simple to manage, yet individuals have a tendency to disregard it. That expedites an
extremely slender way for individuals with stammer issue to experience. The issue is quite
perilously disregarded that disregarding it is the threat itself. John Doe Jr., was discouraged by
his educator when he raised his hand attempting to pose a question. She turned his causes around
not approach him in the wake of raising his hand for an exceptionally long time. He kept his
hand overhead for a significant part of the 75 moment session, yet the educator did not approach
him. (Pena 517) After class, she sent him a message letting him know to not talk in class as it
takes a step back and diverts the nature s domain. What studying environment I might as well ask?
He was there to study! However, it would appear his educator didn t aside from individuals to take
long when making inquiries. This truly
... Get more on HelpWriting.net ...
25. Beowulf Vs Batman Research Paper
Not only is being a hero honorable, but they also have moral ethics, strength and the power to fight
evil. Today, the most popular superhero includes Batman. Beowulf and Batman are similar in many
ways. During the Anglo Saxon period, an unknown author, created the first hero,Beowulf. and
Unlike most heroes, Beowulfcan fight nine sea monsters and cut off Grendel s arm basically with
his bare hands. In the movie Batman, Batman shows his strength by fighting off the villain, the
Joker. Anglo Saxon Hero is a hero who is intelligent and strong, someone who is kind and able to
fight evil at the same time. Besides that, Beowulf s moral ethic is that he only kills when there is
danger. This is similar to batman, he only kills when he feels it s... Show more content on
Helpwriting.net ...
Beowulf is a brave, selfless and strong modern day hero. When Beowulf came to help Hrothgar and
his people, it was hard for Beowulf to fight Grendel. It wasn t an easy task to kill him but he didn t
give up. Beowulf is brave enough to keep trying to kill him. He is a selfless hero, who risked his
life for others. Beowulf is a strong hero who has killed a lot of evil before, he knows he is strong
enough to kill Grendel. He s not afraid of anything, he knows he can beat anything. Throughout
the poem, Beowulf shows how he is brave, strong and selfless. He doesn t give up when there is
evil around him. He fights it off and protects others around him. Beowulf is a modern day
... Get more on HelpWriting.net ...
26. Theme Of Feminism In The God Of Small Things
Arundhati Roy Presents a slice of life in a small Indian town where male hegemony as well as
Androcentric power relation are prevailing on the other hand, she depicts different types of male
and female identity challenging myths. This novel depicts the feministic elements, caste and class
gender, political and childhood exploitation. It does not deal with one particular theme. It
encompasses all the social issues. The dominance of patriarchal voice and treatment of Dalits and
women are mainly focused in this novel. The God of Small Things portrays the struggle of women
in the male dominant conservative society. In this novel women of three generations are discussed.
The first generations is about Mammachi and second is about Ammu and finally Rahel. The three
women are struggled throughout their life and they were not able to survive in a peaceful manner.
Mammachi was often beaten up her husband Pappachi. Ammu and Rahel were divorced in their life
before they begin their family life and both of them returned to Ayemenem. Both of them became
the victims of the so called male chauvinistic society.
Keywords: Class Gender, Caste, Male ... Show more content on Helpwriting.net ...
The women existed in a male chauvinistic society and the women underwent through many bitter
experiences. When we discuss feminism throughout the literary history we can see that women
writers have explored the atrocities committed by men against them. Victimized women brought it
through their writings to the world, it may be related to the culture, tradition, religion, social
acceptance, etc...Women are born as free and her rights are the same as the man and the laws
must be same for men and women. The God of Small Things depicts some important elements of
the life of Mammachi, Ammu and Rahel. Love is always associated with forlornness; it can affect
a person s childhood and may be continued in the whole life of a
... Get more on HelpWriting.net ...
27. Short Term Liquidity And Operating Cash Flows
3.Short term liquidity and operating cash flows. Please be advised good cash flow systems are
necessary for effective operation in the Motor Vehicles Dealers industry. As it is expected,
companies in this industry have expensive purchases that, when combined with low turnover,
can lead to liquidity problems. Liquidity refers to the availability of cash in the near future after
taking account of immediate financial commitments (also known as current liabilities). Cash in
the near future will be available from bank deposits, cash released by sale of stocks and cash
collected from customers. Immediate financial commitments are shown in current liabilities.
The first ratio of liquidity is the current ratio, which is a simple comparison of current assets with
current liabilities. As per IbisWorld, the industry benchmark for current ratio is 1.3 to 1 (7),
which means that for every dollar committed in liabilities, companies have 1.3 in their assets.
Companies which generate cash on a daily basis, such as car retailers, can therefore operate on a
lower current ratio. For our particular sample, the trend has been very similar in the past 5 years
(see graph below). Overall, AHG has presented more solvency and liquidity than APE. *ref 2/3
Another aspect of solvency we need to look at is if the companies have enough short term assets
(without selling inventory) to cover their current liabilities. This is particularly important in times
of crisis, where short term creditors are
... Get more on HelpWriting.net ...
28. Imp Case Analysis
1.Would a TNA be needed in this situation? Why or why not? If yes, who would you want to talk to?
Training Needs Analysis is a formal process required for the purpose of identifying the training gap
that is in existence and its related training need. Considering the IMP case analysis, training needs
analysis is required since there are different sectors within the organization which require an
individual to possess the necessary skills to perform the expected work within that department. In
addition, training is also offered to people working within the different sectors in that organization
despite the fact that equality is not displayed while offering that form of training. Talking to the HR
manager at North America International ... Show more content on Helpwriting.net ...
Other than this, the commission insisted that training was offered to the whole company and not
only on Mr. Pettipas because there could have been some individuals with the same problem but
haven t yet come into light.
4.For the training to be effective, what other things do you think need attention?
For the training to be effective, considering other factors to complement the training is required
such as addressing the element of gender discrimination which was in existence in the organization.
By addressing this form of discrimination training will be considered effective since the same form
of training will be offered for both the males and the females within the organization. In addition,
this will also ensure that the female staff members obtain the same, necessary Knowledge, ability
and skills just like the male staff workers.
5.What would you suggest in the way of evaluation of the training? How would you convince top
management that it would be worth it?
As a way of training evaluation, I would suggest a one on one interview whereby every staff
member will be asked to carry out an activity with respect to the work being carried out in that
respective department of the organization. I would convince the top management that it would be
... Get more on HelpWriting.net ...
29. Cardiac Arrest Medical Case Scenarios
CLINICAL PRACTICE GUIDELINES and STANDARD OPERATING PROCEDURE FOR
CARDIAC ARREST IN INPATIENT CARDIAC SURGERY PATIENTS
POLICY and PROCEDURE FOR MANAGEMENT OF CARDIAC ARREST PATIENTS POST
CARDIAC SURGERY
PURPOSE: To provide guidelines for staff caring for Inpatient Cardiac Surgery population
requiring advanced life support during cardiac arrest events.
SCOPE: All nursing personnel who have been oriented to and/or care for Cardiac Surgery
population. All attending Cardiothoracic Surgery Physicians currently practicing and providing
surgical care within Brooke Army Medical Center. All Trauma Surgery Physicians currently
practicing/providing surgical care to include nightly on call rotations.
I. POST CARDIAC SURGERY CARDIAC ARREST PATIENT... Show more content on
Helpwriting.net ...
Staff should begin setting up for emergent resternotomy once cardiac arrest is noted. Goal is to
have chest opened within 5 minutes. Please verify the physician performing resternotomy is aware
of procedure patient had done (high risk for graft detachment with retractors). Internal cardiac
massage is preferable and more efficient than external cardiac massage (should only be performed
by trained physicians with two hand technique).
g. If patient paced prior to cardiac arrest with functioning epicardial pacing wires and the rhythm
shows PEA with paced rhythm, the pacing spikes may be masking Ventricular Fibrillation. Detach
pacing wires from pacemaker to assess underlying rhythm.
h. For severe bradycardia, Atropine can be given per AHA protocol.
i. Epinephrine should be witheld unless ordered by Cardiac Surgeon (Severe Hypertension with
Return of Spontaneous Circulation ROSC).
j. During external cardiac massage with intra aortic balloon pump (IABP) in place, change trigger
to pressure. If prolonged period without cardiac massage, change trigger to internal at rate of 100
BPM.
V. POST CARDIAC SURGERY CARDIAC ARREST GUIDELINES: Intervention Pulseless
Electrical Activity (PEA)
a. Do not delay external cardiac massage for any more than 1
31. The Effects Of Fitbit Brand On People s Health
Fitbit Over the years, there has been a significant increase of individuals who are seeking to live
healthier lives. These individuals have been looking for a device to help them get on track with
their goals of losing weight, and becoming healthier. Of course, there are pedometers to track
steps, and cell phone apps to help manage diets, but it seems that there have been no improvements
on people s health. So when none of these things were working, the creators of the Fitbit got
together and created a device that would once and for all help the people who are wanting to
improve their lifestyle.The new and hot trendy item of technology is here to help Americans
become healthier, and live betterlives. The Fitbit Flex, Charge, and Surge have become the new
trend over the past few years as Americans seek to be healthier. The Fitbit brand has been proven
to be one of the most trendy and accurate pieces of technology, and is certainly looking to keep
loyal customers on their feet with continuous upgrades to the device. In 2014, Fitbit created its first
ever Fitbit, the Flex. The flex was designed to encourage users to improve their health by having a
braceletthat would track their steps, distance traveled and calories burned. The Fitbit Flex not only
synced wirelessly to Iphone users, but to the newer android phones as well. With the 4.0 bluetooth,
this watchcould sync to any phone, as well as any computer, making users fitness goals easy to
access. After renovations to
... Get more on HelpWriting.net ...
32. Nineteen Eighty-4 Research Paper
Yellow. Yellow is attention grabbing. Fear of the unknown. Entrepreneurialism. Yellow is toxic
sunshine, cycles of creative destruction, false laughter. Disease (Stewart, 73). My paper is about
yellow in Nineteen Eighty Four. In this paper I will be discussing more specifically how the color
yellow is used as symbolism and provides meaning to the themes of Nineteen Eighty Four. The
coloryellow appears many times in the novel Nineteen Eighty Four, occurring 12 times in total.
Initially, one could interpret Orwell s choice to use yellow as simply creative license, but after so
many instances of it during specific thoughts, feelings, and settings, one can infer that Orwell used
this color to indicate more meaning than what lies on the surface.... Show more content on
Helpwriting.net ...
There is the red of Russia, the red of blood, and the red of lobster; all of these could factor into a
story and give it much more meaning, symbolism, and depth than it had when originally written
without chromatic description. Colors are attached to meanings in our minds, we have
associations with each of them, based off both psychology and personal experiences (Kaya and
Epps, 3). The analysis of the hue of yellow begins with color theory and interpretation. The
sciences revealed the reasons why Orwell may have used so many instances of yellow in
Nineteen Eighty Four. The ideas and interpretations developed by scientists and artists alike over
the years led me to discover the true meaning of color and what yellow has been linked to over the
many centuries of humans being able to see color, acknowledge color, name color, and use
... Get more on HelpWriting.net ...
33. Separation Anxiety Disorders And Children Essay
Separation Anxiety Disorders in Parents and Children
Christa Conrad
Antelope Valley College
Introduction to Psychology PSY101
Professor Laurel Johnson
Monday, November 14, 2016
Abstract
The differences between Separation Anxiety Disorder (SAD) and the similar disorder, Attachment
Anxiety Disorder, were examined to show that the disorders are alike. The causes of Separation
Anxiety Disorder and the symptoms in which a child could be diagnosed were discussed.
Following that, the treatments that were presently available and ways parents could do to
counter the onset of this disorder were observed. Lastly, examples presented of the research
studies were observed on a thirteen year old boy and a two year old pointer cross. Both examples
showed how both mother and owner of the dog could figure out how the son and the dog were
diagnosed and how they were treated.
Separation Anxiety disorder
Separation anxiety disorder is a condition that causes a child severe distress when away from the
parents or the caregivers. Studies show that 4 5% of children and adolescents typically have this
disorder. This paper will provide an overview of the present understandings of SAD. The
information covered in this paper will include an example of a study for both a child and an
animal. The areas examined will focus on the causes, symptoms, methods of diagnosis, ways to
prevent it and the treatment currently available for this order.
Separation Anxiety Disorder Vs.
... Get more on HelpWriting.net ...
34. Research Specific Risks, Threats, And Vulnerabilities On...
Research specific risks, threats, and vulnerabilities to Web and social networking applications
Social networking worms: Social networking worms include Koobface, which has become,
according to researchers, the largest Web 2.0 botnet. While a multi faceted threat like Koobface
challenges the definition of worm, it is specifically designed to propagate across social networks
(e.g., Facebook, mySpace, Twitter, hi5, Friendster and Bebo), enlist more machines into its
botnet, and hijack more accounts to send more spam to enlist more machines. All the while
making money with the usual botnet business, including scareware and Russian dating services.
Trojans: Social networks have become a great vector for Trojans click here and you get: Zeus a
potent and popular banking Trojan that has been given new life by social networks. There have
been several recent high profile thefts blamed on Zeus, notably the Duanesburg Central School
district in New York State late in 2009. Once a Zeus Trojan infects a machine, it remains
dormant until the end user visits a Web page with a form to fill out. One of the toolkit s most
powerful features is that it allows criminals to add fields to forms at the browser level. This means
that instead of directing the end user to a counterfeit website, the user would see the legitimate
website but might be asked to fill in an additional blank with specific information for security
reasons. URL Zone is a similar banking Trojan, but even
... Get more on HelpWriting.net ...
35. Tas2r38 Locus Lab Summary
Summary: The objective of the project is to determine if I carry the allele at the TAS2R38 locus.
In order to find that out, DNA was extracted from cells within the mouth. The DNA sample was
quantified, amplified by PCR, ran through gel electrophoresis, purified and sequenced. The
results for my DNA was not able to be determined through sequencing. The DNA samples of the
class recorded that 62% of the participants were tasters (carries the allele at the TAS2R38 locus)
and 38% of the participants were non tasters (does not carry the allele at the TAS2R38 locus).
Objective: The objective of the project is to be able to determine which alleles are carried at the
TAS2R38 locus and verify if the genotype reflects the expected phenotype. Methods:... Show more
content on Helpwriting.net ...
If you are a taster, the paper will seem bitter. If you are not a taster, the paper will not have a
flavor and taste plain. Results and Analysis: Experiment 1 2: The DNA concentration was 60 ng
/ВµL (6.00*10^4 ng/mL). The total yield was 0.6 ng (60 ng/ВµL DNA /100 ВµL H2O). The DNA
sample was divided by 100 ВµL instead of 25 ВµL of H2O because the sample was diluted 4
times. Experiment 3: The forward primer found is 5 ATGCCTTTCGTTTTCTTGGTG 3 . The
reverse primer found is 5 ATCTGCCAGTTGAGCCTTGT 3 . Experiment 4 5: PCR did not work
for my obtained DNA as there was no evidence of movement of the DNA. PCR did work for lab
numbers 33 and 12. The size of my fragment could not be determined and cannot compare to the
size that was expected. The negative control was clean as there was no traces of movements.
Experiment 6: The DNA concentration after TAS2R38 PCR purification and quantification was
0.344 ng/ВµL (34.4 ng/mL). My genotype at the TAS2R38 locus was not determined by the
sequencing. The genotypic frequencies of the class obtained by sequencing: 0.4 (40%) TT, 0.4
(40%) Tt, 0.2 (20%) tt. The allelic frequencies of the class obtained by sequencing: 0.6 (60%) T
and 0.4 (40%)
... Get more on HelpWriting.net ...
36. The Theory Of Planned Behaviour
Executive Summary
This report will endeavour to explain the theory of planned behaviour. The report will outline a
detailed explanation of the theory highlighting all aspects of the theory in some detail with
examples. The report will delve into the applications of the theory of planned behaviour. The report
will highlight the necessary steps in obtaining information needed for the application of the theory.
The theory will then be used to provide an explanation of the behaviour. Strengths and weakness
will be covered throughout the report, via the use of academic journals to assist with the
explanations. Limitations and advantages of the theory of planned behaviour will be covered as
well as recommendations of how the theory can be improved.
What is the theory of planned behaviour?
Attitudes, intentions and behavior have been combined in a comprehensive model of consumer
choice called the theory of planned behavior. (East, Wright Vanhuele 2013, p. 139)
The theory of planned behaviour has been used across many diverse fields; it has assisted
researchers in explaining and predicting health behaviours and intentions which include smoking
and drinking and has been used in conjunction with internet use and buying environmentally
friendly products. The vital factor to this theory is behavioural intent; behavioural intentions are
influenced by the attitude of the individual. The attitude is directed towards the likelihood that the
behaviour will have an
... Get more on HelpWriting.net ...
37. Prejudice And Racism In New York University
The other encounter with the world we live in and racism was in college. We lived in an
apartment style dorm with 4 other people. There were 3 bedrooms and a common area. The
entire building was composed with males and females from all over the world and of different
ethnicities. It was a melting pot just like New York City. My friendship with the other roommates
really opened up my mind to other cultures and understand their differences. It was a very
enlightening experience. We all played sports at the University. Whenever we had free time, our
teammates would come over to our room and we would listen music. Usually it was the R B and
Rap station from the radio station at the University or CDs. We would always have a good time and
... Get more on HelpWriting.net ...
38. Abbot
Risk arbitrage (or merge arbitrage) is a trading strategy related to M amp;A transactions. For
example, if an M amp;A transaction is carried out by means of share exchange between the buzzer
and the target, then an arbitrageur may short sell buyer s stocks and purchase stocks of the target.
Until the acquisition is completed, the stockof the target typically trades below the purchase price.
After the merger is completed, the target s stock will be converted into stock of the acquirer based
on the exchange ratio predetermined in the merger agreement. The arbitrageur delivers the
converted stock into his shortposition to complete the arbitrage.
In an efficient capital market, the price of the target and acquirer will fully and immediately ...
Show more content on Helpwriting.net ...
We should keep in mind that we can remain without deals and try to evaluate deals (short and long)
separately with risk for each stock, volatility of it and other market parameters. Also we should
evaluate probability of cancelation the deals after that we try to
Market should prevent this profit as it contains risk. This profit isn t risk adjusted we always have
risk that deals will not be completed after calculating risk connected to deal we should find new
price corrected by risks.
Option strategy is a hedge for uncovered long position in stocks. If deal will be canceled Smith
receive two positions: short in Abbot and long in Alza. For complete hedge he needs two option
call in Abbot and put in Alza. If he buys put option for Alza he will hedge from price drop in Alza
shares. But he still has risk in from rising Abbot shares. So he decreases risk of the positions.
At the first glance it seems that expected return should be decrease as we decrease risk from
strategy and pay money for this insurance (risk premium for option). If deal is canceled we will
lose less money than without put option. There is a possibility than all market goes down before
the deal and so we can additional return from exercise put option and also keep return from deal.
To say exactly how will be change expected we should calculate probabilities of all possible
situation, but based on risk arbitrage strategy we shouldn t receive additional receive as
... Get more on HelpWriting.net ...
39. Shamanism and the Indigenous Peoples of Siberia Essays
Shamanism and the Indigenous Peoples of Siberia
Shamanism plays a role within most tribal communities of the indigenous peoples of Siberia.
Within the community the shaman has many roles; one of his[1][1] main roles is that of a healer.
The function of the shaman is closely related to the spirit world (Eliade 71). A shamanuses ecstatic
trance to communicate with spirits. Spirits are integral to a shaman s ability to heal within his
community.
Shamanic activity is generally a public function (Grim 11 12). Shamans are highly respected
members of the community. Shamans are of the elect ; recognition of a shaman can only be
bestowed by the entire community (Eliade 7, 17). Without the community, a shaman is not a shaman
... Show more content on Helpwriting.net ...
The gods created man, and he lived happily until the time when the evils spirits spread sickness
and death over the earth. The gods decided to give mankind a shaman to combat disease and death,
and they sent the eagle. (Eliade 69)
Many tribes, other than the Buryat, consider the eagle, sent by the Supreme Being, to be the
creator of the first shaman . These peoples include the Yakut of Turkhansk, Yenisei Ostyak, the
Teleut, and the Orochon. Therefore according to this legend, the shaman s initial purpose was to
exterminate the evil spirits of sickness and death that plagued the people; in other words, one of
the shaman s first purposes was to heal (Eliade 69 71).
As a healer, the shaman puts energy into the community. The shaman dramatizes and makes
visible the incomprehensible mystery of all existence. . . . The shaman s ritual assures the flow of
such vital energy into the community . . . [with the idea that] no man can succeed in life alone, and
he cannot get the help he needs from men (Vilmos Dioszegi qtd. in Grim 13). An individual needs
this assistance from the higher powers of the sacred and the profane in the spirit world; this
assistance can only be achieved with the guidance of the shaman.
The shaman allows the community to perceive holiness of higher powers by experiencing and
absorbing sustaining, healing power and communicating this power to his community. This power
has a transformative quality to it that is
... Get more on HelpWriting.net ...
40. Examples Of Self-Justification In Criminal Justice
The criminal justice system is one of America s most inadvertently accepted institutions throughout
its history. However, the centuries old system is now deeply plagued with self justification, and it is
a bigger problem than people may think. Formulating analytical analogies on self justification.
Examining the effect of self justification that occurs both in the interrogator and the interrogated,
and showing scientific research that pinpoints the use of self justification and cognitive dissonance
in criminal justiceand other institutions; All points show the injustices happening in the justice
system. Analogies of tone, purpose and point of view are all prevalent in self justification.
Whenever somebody slides down the pyramid of choice... Show more content on Helpwriting.net ...
Saul Kassin, a professor of psychology at the John Jay College of Criminal Justice in New York,
conducted an experiment relating to self justification within interrogators. In the experiment,
Kassin paired individuals who were either guilty or innocent of theft with interrogators who were
told as well if a person was innocent or guilty of theft. The combination of a person thinking they
are innocent and the interrogator thinking they guilty, resulted in the most amount of tension
between both parties. Kassin s experiment is a classic example of how self justification can take
over a person s mind. Once a person takes one step down the pyramid of choice, it is harder for
them to see the other side, this is exactly what happened in the experiment. Keise Izuma, another
professor of psychology, conducted a similar experiment outside of the criminal justice system.
Izuma had 52 participants choose their favorite wallpaper out of 2 selections. Izuma would then
have an homes interior expert enter the experiment room and either tell the participants they made
a good decision choosing the wallpaper, or if they had made a horrible decision. The expert either
praised or scolded the participant for ten minutes. 8/10 of the participants that were scolded
switched which wallpaper
... Get more on HelpWriting.net ...
41. Martin Luther King Successful
Have you ever thought about why the leaders of massive revolutions such as the Indian
Independence Movement and the Civil Rights Movement were so successful at initiating change
and getting others to be receptive? Recently, on Martin Luther King Jr. Day, I watched King s
famous, I have a Dream speech that took place on August 28, 1963, following the March on
Washington. While watching, I became very interested and curious about why King was the leader
of this movement. After all, he was one in millions who had suffered from the injustice and cruelty
brought upon the black minority by the white majority. So why King? After analyzing the I have a
Dream speech several times, I came to the conclusion that the main reasons why King was a
successful... Show more content on Helpwriting.net ...
Love is the most powerful force in the universe and King understood this. Despite the fact that he
and his people had been treated with nothing but fear, hate, and cruelty from white men, he had a
great understanding that this same behavior would not solve the issue. You cannot fight fire with
fire. Like many other successful revolutions, King knew that love and peaceful protest was the
only way anything was going to change for his people. King preached that the only way to make
an enemy a friend is through love. Although it may have been very difficult for the majority of
black people to choose love over fear when they hadn t received love their entire lives, he strongly
encouraged his people to not hate the white man, for it would simply make the problem worse.
King understood the only way to achieve true equality is with brotherhood, acceptance, and love
for all living beings. This only begins to scratch the surface of what made Martin Luther King an
incredible leader who made history. By looking at how King was able to communicate his ideas
effectively, we can apply the techniques he used in our own lives in order to become better
communicators. Communicating is certainly one of our greatest assets as human beings and it is a
skill that can change the world, as Martin demonstrated on August 28th, 1963. Through passion,
authenticity, and love,
... Get more on HelpWriting.net ...
42. Conduct Disorder Essay
My hypothesis on conduct disorder in children can lead to criminal activity in adulthood. The
research that was conducted from this question was that of Memorial University of Newfoundland,
the Department of Psychology. Sampson and Laub (1997) discussed conduct disorder as not being
a single cause of adult criminal behavior, but instead the start to what they termed as a life of
cumulative disadvantage . The conduct disorder might indeed be the initial cause of problems, but
may be replaced by the effects of disapproving, negative reactions from others.
Based on prior research, Kratzer and Hodgins (1997) were aware of the association between
conduct problems in childhood and adult criminal behavior. ... Show more content on
Helpwriting.net ...
Well conduct disorder is a complicated group of behavioraland emotional problems in youngsters.
Children and adolescents with this disorder have great difficulty following rules and behaving in a
socially acceptable way. They are often viewed by other children, adults and social agencies as bad
or delinquent, rather than mentally ill.
Some causes for conduct in adolescents are no discipline, unstructured discipline and a broken
home. A broken home is one of the factors that can produce a delinquent child. A broken home
reduces the opportunity for creating a strong attachment between child and parents and that reduces
the parent s ability to condition the child. Many theories concerning the causes of juvenile crime
focus either on the individual or on society as the major contributing influence. Theories centering
on the individual suggest that children engage in criminal behavior because they were not
sufficiently penalized for previous delinquent acts or that they have learned criminal behavior
through interaction with others.
In fact Sampson and Laub (1997) say that isolating criminal behavior as being caused by conduct
disorder does not allow for the array of influences and interactions that lead a child with problems to
criminal activity in adulthood. They suggest that a child with conduct problems starts in on a life of
cumulative disadvantage. The conduct disorder might indeed be the
... Get more on HelpWriting.net ...
43. Osmosis Lab Report
First you must define what diffusion is, diffusion is when molecules in a solute spread from high
concentrated areas into lower concentrated areas, without outside forces acting upon it. Diffusion is
affected by molecular kinetic energy, diffusion can also occur in all three states of matter. Now you
must define osmosis, osmosis is similar to diffusionbut is when water molecules pass through a
semi permeable from the less concentrated solution to the more concentrated solution. In cells
osmosis is not only affected by the concentrationof the solute but also by the resistance of the water
movement. The words hypertonic, hypotonic, and isotonic are used to describe the different
concentrations in these membranes. .A hypertonic solution has... Show more content on
Helpwriting.net ...
You then take the final mass minus the original divided by the original mass and get the percent
of the mass change. You can then conclude that when the egg is in a hypertonic solution such as
corn syrup, water will leave the cell. You should even be able to see a layer of water laying on
top of the corn syrup to back up your conclusion. One drawl back to this lab is you can break the
egg if you are not careful with it after you take the hard shell off. If it is dropped there is a great
possibility that it will break due to the force of the fall. Also if you didn t want to have uneven
results or have a wide margin of error you would have to make sure that the water, vinegar, and
corn syrup are all the same amounts. You would also want to make sure the eggs are the same
size and same brand. You would also want to make sure the cups you use are uniform, that they
are the same size and same width. The same scale must also be used to weigh the eggs. Also you
would need to make sure that each of the eggs are kept at the same temperature. If you don t do
these things then you could end up with inconclusive results, this is because if you use to many
different things you will have to many variables to keep track of which will get confusing and
could mess up your
... Get more on HelpWriting.net ...
44. The Case Of 1984
Conceived Onika Tanya Maraj on December 8, 1984, in Saint James, Trinidad, Minaj is of
blended African, Caribbean, and South Asian history. She spent her younger years in Trinidad,
moving to the United States when she was five years of age to settle with her parents in South
Jamaica, Queens. There her mom functioned as a medical caretaker s aide, attempting to take
care of the family on her $200 every week. Her dad drank vigorously and did drugs, taking cash
and robing his own family to fuel his addiction. In some cases his activities had more compelling
results. At the point when Minaj was a tyke her dad attempted to torch the family s home in an
unsuccessful endeavor to murder her mom. I ve generally had this female giving force... Show more
content on Helpwriting.net ...
In all honesty, the most recent year of my life, I can t let you know where it started and finished,
or what happened in the middle of, Minaj said I can t recall dates, I simply continue onward. I
didn t understand things would move so rapidly, she finished up. The rapper kept on featuring
as a visitor MC onTracks, for example, Sean Kingston s Letting go (Dutty Love) and Jay Sean s
2012 (It Ain t the End) as summer turned to fall, making her announce 50k for a verse, no
Album out, in her rap on the Kanye West track Monster. This large number of cameos helped
Minaj impact the world forever in October of 2010 when she set a record for having the most
songs simultaneously on the Billboard Hot 100 for no fewer than seven entries. Pink Friday
followed quickly right behind Minaj s breakout success, hitting shelves in November of 2010 to
great excitement. People generally agreed that the album was a solid, if not overwhelming, first
appearance. Writing for Rolling Stone, Rob Sheffield noted that there s nothing as weird or
striking as her Monster feature, even as Entertainment Weekly s Brad Wete supported tracks such
as Moment 4 Life that showcase her skill for melody while bragging telling a story her struggles
be they professional or intimate ones of love and hurt. The openly Minaj crisscrossed a variety of
topics on her first appearance, taking on characters of different
... Get more on HelpWriting.net ...
45. Pros And Cons Of The Persian Empire
The Persian Empire is considered one of the most successful empires at its time. What made the
Persian Empire so unique and successful, was because of how sophisticated there government
was. Like other empires the Persian Empire had a religion. This made the people of Persia freely
think about their ruler and help the empire out in any way. The Persian empire compared to
preceding empires, (such as the Assyrian Empire etc) were relatively less oppressive and abusive
to their people. This prevented the empire from collapsing that easily. Which is one reason why
they advanced their rule for another 200 years (1,429 years in Dynasty rule (1979)). As the ruler, I
would implement the ideas and Philosophies that the Persian empire used in order to have a strong
and successful rule. For example the ruler would allow conquered peoples to maintain their culture,
and create a multicultural capital city that contained influences from all over the empire. Though
they are still ruled over their subjects, the multiculturalism will offered a different way to run an
empire. The ruler and the governmentwill also treat the people relatively respectful and practice
their ways in the empire. The ruler will also implement a monotheistic religion which praises one
Godonly. As a ruler, a skilled military society will also be beneficial to dominant imperial power.
To avoid the mistakes of the Assyrians, who attempted to rule everything from a central location,
the ruler will also divide the
... Get more on HelpWriting.net ...
46. My Favorite Vacation Essay
One of my favorite vacations We were all watching tv there was a football game on. My dad got
up and asked Graham, Dallas and I to go in to Graham s room. He told us that us three we re
going to colorado if we didn t have anything important going on. None of us thought we had
anything but it turns out that Dallas, who s a sophomore in high school, had too many test
going on so that meant Dallas wasn t going. We were all pretty bummed but not enough to not
go. Graham started packing right away. I didn t pack till last minute, that may have been a
mistake. When school ended Dallas picked us up and I raced up stairs packing as fast as I
could. In about an hour we had everything in the car and ready to go. We were off to colorado.
Me and Graham were sitting in the back while our dad sat in the front. Our dad then gave us two
options we could go straight to colorado or stay in a hotel. We all decided it was best to stay at a
hotel by the time we got there it was almost 10 o clock. We stopped at a hotel in Ellis Kansas.
They had a pool and a hot tub just our luck it felt so good on our sore legs. Then we went straight
to bed in surprised all of us how quickly we fell asleep. The next morning we ate breakfast there
and continued to our destination. We had eight more hours me and my brother fell asleep for
most of it we woke up just before we entered the mountains. There wasn t really any snow so we
were all a little worried that we wouldn t be able to go on the mountain. We
... Get more on HelpWriting.net ...
47. A Sunny Afternoon Of A California Bank
It s a sunny afternoon in a California bank. The air is crisp and clean, the birds are bright and
cheery, and the weather is all but perfect. Suddenly, a man bursts through the front doors, gun in
hand. He orders everyone to drop to the ground and forces the bank manager to open up the safe.
In that situation, everyone would know what to do. But what if the man had walked through the
doors in a suit, claimed to be from corporate I.T. and wanted to check the power voltage on the
branch s computers (Street, Ruin )? Would you recognize it as a crime? In 2011, this is exactly
how one major financial institution had their data stolen by Jayson E. Street (Street, Ruin ).
Fortunately, the threat was not real, and Street had been hired by the... Show more content on
Helpwriting.net ...
Both the government and the private sector have been aware of the threat social engineering poses
to information security since the 1980s, but it has only gained public notoriety within the last
decade. Still, while today s corporations may be prepared for a raid by anonymous cyber terrorists
striking from overseas, they continue to turn a blind eye to the dangers of socially engineered
attacks. Thanks to a combination of corporate oversight and poor employee training, hackers with
zero coding knowledge are able to penetrate their secured buildings and wreak havoc. In order to
combat this vulnerability, the Department of Homeland Security should take an active role in the
operational security of major American businesses through extensive auditing and employee
training.
Of course, this problem did not emerge overnight. Low tech attack techniques have existed long
before the invention of the computer. Dumpster diving is one of the oldest methods of information
gathering, a vital step for any attack. Today, most firms simply toss their paper out in the trash
without shredding. These documents can contain confidential information such as passwords or
financial data. Even papers headlined with Do Not Disseminate or Confidential get tossed in the
trash with everything else. Johnny Long, a penetration tester, jokingly proposed that those
documents
... Get more on HelpWriting.net ...
48. Gil And Inez s Midnight In Paris
When you hear the words romance films , Woody Allen instantly pops up in your mind. He is a
director known for being cheesy and creative. His movies can be absolutely moving or heart
breaking. Anyways, they always have a charming touch. Indeed, Midnight in Paris it s a
romance fantasy movie released in 2011. It is set in Paris and follows an engaged couple, Gil
and Inez. Gil is a writer who spends his time day dreaming about the stylish Paris under the rain in
the 40s while Inez thinks its overrated. Likewise, she is keen on materialistic stuff. During the trip,
the couple face many dramatic issues, beginning with the fact that Gil found a way to travel to the
past in his favorite decade but he must leave cautiously so no one would suspect.
... Get more on HelpWriting.net ...
49. The Conflict Within The Family, By Alison Bechdel, Joan...
Families, which are basic units of human commit, are constructed from individuals with unique
character; these individuals taken as a whole, construct the larger character of the family itself.
However, because no individual s character is perfectly compatible with another s, there exist
inevitable conflict within the family, such as can be expressed as conflict between the self and
either another single member or the entire group. Naturally, the rational self will seek to
ameliorate such as conflict, perhaps by simply accepting it as a natural part of human life. Other
instances, which form the basis of the essay and find roots in essays by Alison Bechdel, Joan
Didion, and Richard Rodriguez, occur when such acceptance does not. I strongly suggest that the
common response to familial conflict, avoidance, that is, escaping the friction between human
characters by refusing on some level to participate in family, introduces a new conflict. While
Didion, Bechdel, and Rodriguez, provide textual support to the birth of this second conflict, I
shall seek to explain its nature. Born of contrasting characters in family and self, conflict will not
be replaced, but bolstered in avoidance. Thus, in acceptance, the self finds resolution. Though I
say it nonetheless, it is fairly obvious that most people participate in some kind of a familial unit
as previously described, and thus are familiar with the conflicts to which I alluded. The piece by
Joan Didion, entitled On Going
... Get more on HelpWriting.net ...
50. Usps
В®
Pla n t o Profit a bilit y
5 Y e a r Busine ss Pla n
February 16, 2012
Introduction
пЃ±
The United States Postal Service ( USPS ) continues to endure the negative effects of electronic
diversion combined with a weak economy and increased funding obligations
пЃ±
This confluence of events has had financial impacts on the organization which have become
untenable
пЃ±
While the USPS has continuously sought to make operational improvements and improve
efficiency, the organization s current financial position requires additional action to ensure viability
and self sufficiency
пЃ±
The following presentation has been prepared by the USPS in order to communicate its business
plan ( Business Plan ) to key stakeholders ... Show more content on Helpwriting.net ...
Fixed cost base
 Transactional volume
declining due to e diversion  Advertising mail is subject to more substitution options  Mail
volume highly sensitive to economic changes  Mail mix changes lost profit contributions These
trends will continue to put pressure on USPS s ability to provide affordable universal service
Price
Labor Costs
 ~80% of total costs  COLA increases  Benefits: pensions,
51.  Capped by inflation
 Price elasticities are in
flux due to growing alternatives Rising but capped Rising cost per hour
retiree health, health insurance  Limited flexibility
February 16, 2012
4
Electronic Diversion is the Primary Driver of First Class Mail Volume Decline
пЃ±
Diversion of communication and commerce to electronic channels is a principal contributor to
declining First Class Mail volumes
пЃ±
Diversion reflects a permanent secular shift in customer behavior and is more pronounced during
periods of economic weakness
пЃ±
First Class Mail represents 44% of mail volumes and 66% of contribution
пЃ±
Diversion exacerbates the loss of profit as revenues decline
The Economy is NOT the Main Cause of Diversion
180% 160% 140% 120%
Recent Examples of Diversion
пЃ±
Alternatives to bill payments by mail
пЃ±
Online presentment of bills and statements
пЃ±
E mail as a substitute for mailed correspondence
Index
52. пЃ±
E file of tax returns
100% 80% 60% 40% 20% 0%
Loss of 45 bn pieces
пЃ±
Electronic
... Get more on HelpWriting.net ...
53. Essay on Graffiti as an Artform
Graffiti as an Artform The value of any message or work of art, whether it is hanging on the wall
of a gallery or a subway, lies on the intensity of the artist s or vandal s beliefs. Graffiti is an
uncertain issue in respect to its virtue. While the voice of the individual must never be lost in a
society of shouts growing larger and louder every second; graffitiis such a public medium that its
integrity must be of great concern. Graffiti is a vast wasteland of indefinite opinions. Foremost
graffiti is illegal and a form of vandalism, it invades peoples privacy and destroys their property.
However, graffiti can be a means by which one may permanently express one s self. It has the
potential to convey a powerful, relevant... Show more content on Helpwriting.net ...
Even legitimate complaints about the behavior of some individuals should not be expressed in this
manner, they are to be judged within the walls of a courtroom not on the walls of a bathroom.
Another reason why people engage in graffiti is to shape their identities. They wish to leave a
mark in a permanent environment exclaiming to the rest of the world that they exist, that even
though their voices may be lost before politicians, parent, and peers they are real and the
spraypaint is proof of this. This form of graffiti is easily passed off as mere vandalism and
considered an annoyance to our society but when viewed with more compassion, it becomes
clearer how important of an outlet this form of graffiti is. Especially for today s youth (a
generation that often feels insignificant) it is psychologically important for them to have solid,
material evidence of their own existence. Correlated with identity based graffiti is another type
called tagging. Tagging refers to types of graffiti that range from stylized signature [tags] to mural
size [pieces] that elaborately blend fanciful script, cartoon characters and messages with the artist s
street name (Beaty 43). This is a questionable form of expression for it does not actually exhibit a
need for acknowledgment but rather a recreational engagement, an act of boldly testing the
boundaries of the law in
... Get more on HelpWriting.net ...