SlideShare a Scribd company logo
1 of 58
Download to read offline
Making biology easier to
       engineer

           Reshma Shetty
    rshetty@ginkgobioworks.com
1976

• Bio-manufacturing
• Therapeutics
• Better crops
• Bioremediation
• Energy production
2006

• Bio-manufacturing
• Therapeutics
• Better crops
• Bioremediation
• Energy production
Engineering design cycle

          Design

Testing            Construction
Design cycle is slow in biology

                    Design
                (unpredictable)

  Testing                         Construction
(poor technology)                    (slow)
Standardization
  Refinement
 Measurement
    Reuse
Standardization
BioBrick®         standard parts


 EcoRI   XbaI   BioBrick part   SpeI   PstI




                                              Knight, 2003
BioBrick®                       standard assembly
  E   X       BioBrick part 1       S    P           E   X        BioBrick part 2       S   P



   Digest with                                                             Digest with
EcoRI and SpeI                                                             XbaI and PstI
  E   X       BioBrick part 1       S                E   X        BioBrick part 2       S   P




                                                     Ligate
          E   X        BioBrick part 1       Mixed       BioBrick part 2      S     P
A
    AB
B
         ABCD
C
    CD
D

E
    EF
F
         EFGH
G
    GH
H
Why use   BioBrick®   parts?

To assemble multi-part systems
Vector assembly from parts
                E   X               1       S   P


            *                                       *


                    pSB4K5-I52002:
                    BioBrick vector

                        4               K


                              x7


                            Shetty et al., J Biol Eng, 2008
Multi-gene pathways


 Gene A   Gene B      Gene C
Refinement
Two-population
     cell-cell signaling Output
     pathway                                                 Quorum-
                                                  Sender     Sensing
                                                             System
       Sender               Receiver                                    8

                                                 Receiver      Output

        Input




System Engineers
                                                                        7
Device Engineers




                                    BBa_F2620       PoPS                6
                       3OC6HSL




                    R0040   B0034      C0062     B0015 R0062
                                                                        5




                AHL
                                       luxP(R)
                       LuxR                      GFP (LVA)              4

                                 luxP(L)




Device Engineers
                                                                        3
Biologists




             LuxR                      LuxI           LuxCDABE
                                                                        2




                                                                        1
LuxR   LuxI   LuxCDABE
Device
Engineers
Biologists
AHL
                   luxP(R)
      LuxR                   GFP (LVA)

             luxP(L)




                                  Weiss & Knight, 2000
R0040   B0034   C0062   B0015 R0062




                        Canton et al., Nat Biotech, 2008
BBa_F2620           PoPS
3OC6HSL




                  Canton et al., Nat Biotech, 2008
BBa_F2620                                                                                                                                                                                             BBa_F2620
                 3OC6HSL                                                           PoPS Receiver
                 Mechanism & Function                                                                                                                                                                         Component Parts
                 A transcription factor (LuxR) that is active in the presence
                 of a cell-cell signaling molecule (3OC6HSL) is controlled by
                 a regulated operator (PLtetO-1). Device input is 3OC6HSL.
                 Device output is PoPS from a LuxR-regulated operator. If                                                                                                                   R0040 B0034                 C0062       B0015 R0062
                 used in a cell containing TetR then a second input such as                                                                                                                 PLtetO-1 RBS                luxR        Term. Plux,R
                 aTc can be used to produce a Boolean AND function.

                   Static Performance*                                                                                           Dynamic Performance*




                                                                                                                                                                                                                                                                         http://parts.mit.edu/registry/index.php/Part:BBa_F2620
                                                                   600                                             8                                                          600                                                                        8




                                                                                                                                  GFP synthesis rate (molecules cell−1 s−1)
                       GFP synthesis rate (molecules cell−1 s−1)
                                                                          Population Mean
                                                                          Colony Range                             7                                                                        + 3OC6HSL                                                    7
                                                                   500    Hill Equation                                                                                       500
                                                                                                                   6                                                                                                                                     6
                                                                   400                                                                                                        400
                                                                                                                   5                                                                                                                                     5




                                                                                                                                                                                                                                                         PoPS cell−1
                                                                                                                   PoPS cell−1
System
                                                                   300                                             4                                                          300                                                                        4

                                                                                                                   3                                                                                                                              3
                                                                   200                                                                                                        200                                 GFP synthesis rate (Low Input)
                                                                                                                   2                                                                                              GFP synthesis rate (High Input) 2
                                                                   100                                                                                                        100                                 Polynomial Fit (High Input)
                                                                                                                   1                                                                                              PoPS (High Input)               1




Engineers
                                                                     0                                             0                                                            0                                                                        0
                                                                     0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04                                                           −10          0         10         20         30       40             50
                                                                                       [3OC6HSL] (M)                                                                                                          Time (min)


                                                                     Pmax [3OC6HSL]n        Pmax: 6.6 PoPS cell-1                                            BBa_F2620 Response Time:           <1 min
                  Pout =                                                                    K: 1.5E-09 M 3OC6HSL                                             BBa_T9002 Response Time:           6±1 min
                                                                     K n + [3OC6HSL]n       n: 1.6                                                           Inputs: 0 M (Low), 1E-07 M (High) 3OC6HSL

                   Input Compatibility*                                                                                          Reliability**




Device
                                                                   600                                             8
                                                                          C4HSL
                       GFP synthesis rate (molecules cell−1 s−1)




                                                                          C6HSL                                    7
                                                                   500
                                                                          3OC6HSL
                                                                                                                   6
                                                                          C7HSL                                                                                                                                   92
                                                                   400
                                                                                                                   5                                                                                         74
                                                                          C8HSL




                                                                                                                                                                                                               gs
                                                                                                                   PoPS cell−1
                                                                                                                                                                                                        56




                                                                                                                                                                                                            lin
                                                                          3OC8HSL




Engineers
                                                                   300                                             4                                                                                  38                                           92




                                                                                                                                                                                                          ub
                                                                                                                                                                                1E0
                                                                          C10HSL




                                                                                                                                                                                                                                                                       Signaling Devices
                                                                                                                                                                              GFP     1E1




                                                                                                                                                                                                        Do
                                                                                                                                                                                                 20
                                                                                                                                                                                   (arb1E2 1E3 1E4                                            74




                                                                                                                                                                                                                                                 gs
                                                                          C12HSL                                   3                                                                   itrar
                                                                   200                                                                                                                      y un                                         56




                                                                                                                                                                                                                                              lin
                                                                                                                                                                                                 its)




                                                                                                                                                                                                                                            ub
                                                                                                                   2                                                                                                                   38
                                                                                                                                                                                  Low Input                   GFP1E0 1E1




                                                                                                                                                                                                                                          Do
                                                                                                                                                                               (0 M 3OC6HSL)                       (arb 1E2 1E3 20
                                                                   100                                                                                                                                                 itrar
                                                                                                                   1                                                                                                        y un 1E4
                                                                                                                                                                                                                                its)
                                                                                                                                                                                                                 High Input
                                                                    0                                              0                                                                                         (1E -7 M 3OC6HSL)
                                                                     0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04
                                                                                         [AHL] (M)                                                         Genetic:                                 >92/>56 culture doublings
                   Part Compatibility (qualitative)                                                                                                        Performance:                             >92/>56 culture doublings
                                                                                                                                                                                                 (low/high input during propagation)
                     Chassis:     MC4100, MG1655, and DH5
                     Plasmids:    pSB3K3 and pSB1A2
                                                                                                                                 Conditions (abridged)
                     Devices:     E0240, E0430 and E0434
                                                                                                                                 Output:      PoPS measured via BBa_E0240
                                                                                                                                 Culture:     Supplemented M9, 37ºC
                  Transcriptional Output Demand (low/high input)                                                                 Plasmid:     pSB3K3
                  Nucleotides: 0 / 6xNt nucleotides cell-1 s-1                                                                   Chassis:     MG1655
                  Polymerases: 0 / 1.5E-1xNt RNAP cell-1                                                                         *Equipment: PE Victor3 multi-well fluorimeter
                               (Nt = downstream transcript length)                                                               **Equipment: BD FACScan cytometer


            Authors:                                      Barry Canton
                                                          Ania Labno                        Registry of Standard Biological Parts                                                                                                License: Public
            Updated:                                      March 2008                                  making life better, one part at a time




                                                                                                                                                                                                                                 Canton et al., Nat Biotech, 2008
Two-population
cell-cell signaling Output
pathway                                 Quorum-
                             Sender     Sensing
                                        System
  Sender          Receiver

                             Receiver    Output

   Input
Two-population
     cell-cell signaling Output
     pathway                                                 Quorum-
                                                  Sender     Sensing
                                                             System
       Sender               Receiver                                    8

                                                 Receiver      Output

        Input




System Engineers
                                                                        7
Device Engineers




                                    BBa_F2620       PoPS                6
                       3OC6HSL




                    R0040   B0034      C0062     B0015 R0062
                                                                        5




                AHL
                                       luxP(R)
                       LuxR                      GFP (LVA)              4

                                 luxP(L)




Device Engineers
                                                                        3
Biologists




             LuxR                      LuxI           LuxCDABE
                                                                        2




                                                                        1
Measurement
Standard unit: the Ohm
Promoter reference


   BBa_J23101
   tttacagctagctcagtcctaggtattatgctagc
Measurement kit
E   X      E0240          S   P



                                             E. coli strain
    GFP reporter
                                                TOP10
    pUC            AmpR


E   X      P1010          S   P   E    X             E0240    S   P



 Medium copy                          Promoter reference
BioBrick plasmid                          standard
    p15A           KanR               p15A          KanR
Measurement kit instructions
Promoter strength in AU
Promoter strength in SPU
Promoter strength
                 across laboratories




MIT, Virginia Tech, Johns Hopkins, Berkeley, LBL, Harvard, Brown   C.V.=0.113
Characterized promoter library
Lessons

• Ad hoc reference standards are useful
• Reference standards materials and
  instructions should be distributed
• Standards enable comparison of parts
• Standards help to identify sources of
  variability for part improvement
Reuse
The host cell is a chassis

                        System




   Replication   Transcription Translation   Degradation



                         Cellular Chassis
A biological virtual machine

            System
                     Virtual
                     Machine




            Cellular Chassis
System is coupled to the
                  chassis
a
                   Ribosomes




                   RNA Polymerases

    Chassis gene                             Engineered System



b
                    Ribosomes        O-ribosomes
Decouple system and chassis
                     RNA Polymerases

    Chassis gene                                     Engineered System



b
                       Ribosomes             O-ribosomes




                                       T7 RNAP

                   RNA Polymerases
    Chassis gene                                     Engineered System
Orthogonal transcription and
     translation (VM1)
                                O-ribosome generator
                          O-ribosome generator
                                                       O-ribosomes
                       mutated rrnB rrnB
                            mutated
              PBAD
  Arabinose




                                       T7 generator

                        RBS    T7 RNAP       T
              lacUV5
    IPTG                                                T7 RNAP
GFP expression is specific
                                40E+4
                                             VM1 + Reporter
                                             T7 RNAP + Reporter
                                             O-ribosomes + Reporter
Fluorescence (Relative Units)




                                             VM1
                                30E+4        VM1 (Uninduced)



                                20E+4



                                10E+4



                                   0
                                       0.0    0.2   0.4     0.6    0.8    1.0    1.2   1.4   1.6
                                                          Cell Density (OD600)
VM1 consumes RNAP and
 ribosomes from the cell
                              O-ribosome generator
                        O-ribosome generator
                                                     O-ribosomes
                     mutated rrnB rrnB
                          mutated
            PBAD
Arabinose




                                     T7 generator

                      RBS    T7 RNAP       T
            lacUV5
  IPTG                                                T7 RNAP
Auto-regulating T7 RNAP and
   O-ribosomes (VM2.0)
                       O-ribosome generator
                                                        O-ribosomes
                    mutated rrnB
   T7lacM




                             T7 autogenerator (BBa_I20257)

            O-RBS     lacI    O-RBS     T7 RNAP        T       LacI
   T7lacM

                                                             T7 RNAP
VM2.0 expresses GFP
                                   1.2
Fluorescence/OD (Relative Units)




                                    1

                                   0.8

                                   0.6

                                   0.4

                                   0.2

                                    0
                                         VM2.0    T7 RNAP      O-ribosome    VM2.0 +
                                                 Generator +   Generator +   Reporter
                                                  Reporter      Reporter
VM2.0 requires a                              lacIQ          strain
                       O-ribosome generator
                                                        O-ribosomes
                    mutated rrnB
  T7lacM




                             T7 autogenerator (BBa_I20257)

            O-RBS     lacI    O-RBS     T7 RNAP        T       LacI
   T7lacM

                                                             T7 RNAP
O-ribo

 Redesigned T7 autogenerator
                                 mutated rrnB
                   T7lacM



 for increased lacI expression
                                    o-ribosome autogenerator (BBa_I20257)
                                            T7 generator
                                                                              o-ribo
T7 autogenerator                mutated rrnBO-RBS
                            O-RBS   lacI              T7 RNAP         T
                   T7lacM
    (VM2.0)        T7lacM

                                                                               T7



                                                           T7 autogenerator

T7 autogenerator        o-RBS    T7 RNAP      T       o-RBS    lacI       T
    (VM2.2)        T7lacM
                                                                                T7
VM2.2 works in E. coli TOP10
                                 2.0E+4
                                            VM2.2 + Reporter
                                            T7 RNAP Autogenerator + Reporter
                                            O-ribosome Generator + Reporter
 Fluorescence (Relative Units)




                                 1.6E+4     Reporter
                                            VM2.2

                                 1.2E+4


                                 0.8E+4


                                 0.4E+4


                                  0E+4
                                      0.0   0.2   0.4    0.6 0.8 1.0 1.2       1.4   1.6   1.8
                                                        Cell Density (OD600)
VM2.2 is less active than VM1
                          12E+4                                                                                                   12E+4
                                             VM1.2 + Reporter                                                                              VM2.2 + Reporter
                                             T7 RNAP + Reporter                                                                            T7 RNAP Autogenerator + Reporter
                          10E+4              O-ribosomes + Reporter                                                               10E+4    O-ribosome Generator + Reporter
Fluorescence (Relative Units)




                                             Reporter                                                                                      Reporter
                                             VM1.2
                                                                                                                                           VM2.2
                                8E+4                                                                                              8E+4


                                6E+4                                                                                              6E+4


                                4E+4                                                                                              4E+4


                                2E+4                                                                                              2E+4


                                0E+4                                                                                              0E+4
                                       0.0   0.2      0.4        0.6 0.8 1.0 1.2                              1.4     1.6   1.8      0.0   0.2     0.4        0.6 0.8 1.0 1.2                                  1.4     1.6   1.8
                                                                 Cell Density (OD600)                                                                         Cell Density (OD600)

                                                                                 O-ribosome generator                                                             o-ribosome generator
                                                                           O-ribosome generator
                                                                                                        O-ribosomes                                                                                      o-ribosomes
                                                                        mutated rrnB rrnB
                                                                             mutated                                                                          mutated rrnB
                                                               PBAD                                                                              T7lacM
                                                   Arabinose




                                                                                                                                                                                         T7 autogenerator
                                                                                        T7 generator
                                                                                                                                                                                                               LacI
                                                                                                                                                      o-RBS    T7 RNAP       T       o-RBS   lacI    T
                                                                         RBS    T7 RNAP       T                                                  T7lacM
                                                               lacUV5
                                                     IPTG                                                T7 RNAP                                                                                            T7 RNAP
Standardization
  Refinement
 Measurement
    Reuse
Constructive synthetic biology

         Make it fun
        Make it safe
        Make it open
iGEM is a proof-of-concept
Thank you


team@ginkgobioworks.com
http://ginkgobioworks.com

More Related Content

Similar to Making biology easier to engineer - September 18, 2008

Ligandbiasslideset 120313210323-phpapp02
Ligandbiasslideset 120313210323-phpapp02Ligandbiasslideset 120313210323-phpapp02
Ligandbiasslideset 120313210323-phpapp02Patty Ahrweiler
 
Vision based autonomous robot navigation
Vision based autonomous robot navigationVision based autonomous robot navigation
Vision based autonomous robot navigationSpringer
 
Bonnal bosc2010 bio_ruby
Bonnal bosc2010 bio_rubyBonnal bosc2010 bio_ruby
Bonnal bosc2010 bio_rubyBOSC 2010
 
Semiconductor Sequencing Applications for Plant Sciences
Semiconductor Sequencing Applications for Plant SciencesSemiconductor Sequencing Applications for Plant Sciences
Semiconductor Sequencing Applications for Plant SciencesThermo Fisher Scientific
 
[iGEM Workshop] Coming up with a Project
[iGEM Workshop] Coming up with a Project[iGEM Workshop] Coming up with a Project
[iGEM Workshop] Coming up with a Projectigemiitkgp
 
Newcastle iGEM Presentation 2009
Newcastle iGEM Presentation 2009Newcastle iGEM Presentation 2009
Newcastle iGEM Presentation 2009Morgan Taschuk
 
Timing system for picosecond laser power point
Timing system for picosecond laser power pointTiming system for picosecond laser power point
Timing system for picosecond laser power pointbncscientific
 
Mexico 3070 user group meeting 2012 test coverage john
Mexico 3070 user group meeting 2012  test coverage johnMexico 3070 user group meeting 2012  test coverage john
Mexico 3070 user group meeting 2012 test coverage johnInterlatin
 
BioPerl: The evolution of a Bioinformatics Toolkit
BioPerl: The evolution of a Bioinformatics ToolkitBioPerl: The evolution of a Bioinformatics Toolkit
BioPerl: The evolution of a Bioinformatics ToolkitJason Stajich
 
Ion Proton™ Sequencer - The Benchtop Genome Center
Ion Proton™ Sequencer - The Benchtop Genome CenterIon Proton™ Sequencer - The Benchtop Genome Center
Ion Proton™ Sequencer - The Benchtop Genome CenterThermo Fisher Scientific
 
Acs dispensing processes profoundly impact biological assays, computational ...
Acs  dispensing processes profoundly impact biological assays, computational ...Acs  dispensing processes profoundly impact biological assays, computational ...
Acs dispensing processes profoundly impact biological assays, computational ...Sean Ekins
 
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010mzhou45
 
Gupta cell verification dv club
Gupta cell verification dv clubGupta cell verification dv club
Gupta cell verification dv clubObsidian Software
 
Cell Verification Metrics
Cell Verification MetricsCell Verification Metrics
Cell Verification MetricsDVClub
 
Adam Margolin & Nicole DeFlaux Science Online London 2011-09-01
Adam Margolin & Nicole DeFlaux Science Online London 2011-09-01Adam Margolin & Nicole DeFlaux Science Online London 2011-09-01
Adam Margolin & Nicole DeFlaux Science Online London 2011-09-01Sage Base
 

Similar to Making biology easier to engineer - September 18, 2008 (20)

Ligandbiasslideset 120313210323-phpapp02
Ligandbiasslideset 120313210323-phpapp02Ligandbiasslideset 120313210323-phpapp02
Ligandbiasslideset 120313210323-phpapp02
 
Vision based autonomous robot navigation
Vision based autonomous robot navigationVision based autonomous robot navigation
Vision based autonomous robot navigation
 
Bonnal bosc2010 bio_ruby
Bonnal bosc2010 bio_rubyBonnal bosc2010 bio_ruby
Bonnal bosc2010 bio_ruby
 
Semiconductor Sequencing Applications for Plant Sciences
Semiconductor Sequencing Applications for Plant SciencesSemiconductor Sequencing Applications for Plant Sciences
Semiconductor Sequencing Applications for Plant Sciences
 
[iGEM Workshop] Coming up with a Project
[iGEM Workshop] Coming up with a Project[iGEM Workshop] Coming up with a Project
[iGEM Workshop] Coming up with a Project
 
Newcastle iGEM Presentation 2009
Newcastle iGEM Presentation 2009Newcastle iGEM Presentation 2009
Newcastle iGEM Presentation 2009
 
Timing system for picosecond laser power point
Timing system for picosecond laser power pointTiming system for picosecond laser power point
Timing system for picosecond laser power point
 
PCAPP Monthly Status Briefing - September 2011
PCAPP Monthly Status Briefing - September 2011PCAPP Monthly Status Briefing - September 2011
PCAPP Monthly Status Briefing - September 2011
 
Mexico 3070 user group meeting 2012 test coverage john
Mexico 3070 user group meeting 2012  test coverage johnMexico 3070 user group meeting 2012  test coverage john
Mexico 3070 user group meeting 2012 test coverage john
 
BioPerl: The evolution of a Bioinformatics Toolkit
BioPerl: The evolution of a Bioinformatics ToolkitBioPerl: The evolution of a Bioinformatics Toolkit
BioPerl: The evolution of a Bioinformatics Toolkit
 
Ion Proton™ Sequencer - The Benchtop Genome Center
Ion Proton™ Sequencer - The Benchtop Genome CenterIon Proton™ Sequencer - The Benchtop Genome Center
Ion Proton™ Sequencer - The Benchtop Genome Center
 
Acs dispensing processes profoundly impact biological assays, computational ...
Acs  dispensing processes profoundly impact biological assays, computational ...Acs  dispensing processes profoundly impact biological assays, computational ...
Acs dispensing processes profoundly impact biological assays, computational ...
 
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
 
BMES Conference Poster
BMES Conference PosterBMES Conference Poster
BMES Conference Poster
 
Gupta cell verification dv club
Gupta cell verification dv clubGupta cell verification dv club
Gupta cell verification dv club
 
Cell Verification Metrics
Cell Verification MetricsCell Verification Metrics
Cell Verification Metrics
 
Adam Margolin & Nicole DeFlaux Science Online London 2011-09-01
Adam Margolin & Nicole DeFlaux Science Online London 2011-09-01Adam Margolin & Nicole DeFlaux Science Online London 2011-09-01
Adam Margolin & Nicole DeFlaux Science Online London 2011-09-01
 
I-ironic
I-ironicI-ironic
I-ironic
 
Biochip deepti
Biochip deeptiBiochip deepti
Biochip deepti
 
PCAPP Monthly Status Briefing November 2011
PCAPP Monthly Status Briefing November 2011PCAPP Monthly Status Briefing November 2011
PCAPP Monthly Status Briefing November 2011
 

Recently uploaded

Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdfHyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdfPrecisely
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):comworks
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsPixlogix Infotech
 
Vertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsVertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsMiki Katsuragi
 
Take control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteTake control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteDianaGray10
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupFlorian Wilhelm
 
"ML in Production",Oleksandr Bagan
"ML in Production",Oleksandr Bagan"ML in Production",Oleksandr Bagan
"ML in Production",Oleksandr BaganFwdays
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity PlanDatabarracks
 
Commit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyCommit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyAlfredo García Lavilla
 
Connect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationConnect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationSlibray Presentation
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024Stephanie Beckett
 
SAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxSAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxNavinnSomaal
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfAlex Barbosa Coqueiro
 
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxLoriGlavin3
 
Search Engine Optimization SEO PDF for 2024.pdf
Search Engine Optimization SEO PDF for 2024.pdfSearch Engine Optimization SEO PDF for 2024.pdf
Search Engine Optimization SEO PDF for 2024.pdfRankYa
 
Advanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionAdvanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionDilum Bandara
 

Recently uploaded (20)

Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdfHyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
 
DMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special EditionDMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special Edition
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and Cons
 
Vertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsVertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering Tips
 
Take control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteTake control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test Suite
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project Setup
 
"ML in Production",Oleksandr Bagan
"ML in Production",Oleksandr Bagan"ML in Production",Oleksandr Bagan
"ML in Production",Oleksandr Bagan
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity Plan
 
Commit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyCommit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easy
 
Connect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationConnect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck Presentation
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024
 
SAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxSAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptx
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdf
 
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
 
Search Engine Optimization SEO PDF for 2024.pdf
Search Engine Optimization SEO PDF for 2024.pdfSearch Engine Optimization SEO PDF for 2024.pdf
Search Engine Optimization SEO PDF for 2024.pdf
 
Advanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionAdvanced Computer Architecture – An Introduction
Advanced Computer Architecture – An Introduction
 

Making biology easier to engineer - September 18, 2008

  • 1. Making biology easier to engineer Reshma Shetty rshetty@ginkgobioworks.com
  • 2. 1976 • Bio-manufacturing • Therapeutics • Better crops • Bioremediation • Energy production
  • 3. 2006 • Bio-manufacturing • Therapeutics • Better crops • Bioremediation • Energy production
  • 4.
  • 5. Engineering design cycle Design Testing Construction
  • 6. Design cycle is slow in biology Design (unpredictable) Testing Construction (poor technology) (slow)
  • 7. Standardization Refinement Measurement Reuse
  • 9. BioBrick® standard parts EcoRI XbaI BioBrick part SpeI PstI Knight, 2003
  • 10. BioBrick® standard assembly E X BioBrick part 1 S P E X BioBrick part 2 S P Digest with Digest with EcoRI and SpeI XbaI and PstI E X BioBrick part 1 S E X BioBrick part 2 S P Ligate E X BioBrick part 1 Mixed BioBrick part 2 S P
  • 11. A AB B ABCD C CD D E EF F EFGH G GH H
  • 12. Why use BioBrick® parts? To assemble multi-part systems
  • 13. Vector assembly from parts E X 1 S P * * pSB4K5-I52002: BioBrick vector 4 K x7 Shetty et al., J Biol Eng, 2008
  • 14. Multi-gene pathways Gene A Gene B Gene C
  • 16.
  • 17. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver 8 Receiver Output Input System Engineers 7 Device Engineers BBa_F2620 PoPS 6 3OC6HSL R0040 B0034 C0062 B0015 R0062 5 AHL luxP(R) LuxR GFP (LVA) 4 luxP(L) Device Engineers 3 Biologists LuxR LuxI LuxCDABE 2 1
  • 18.
  • 19.
  • 20. LuxR LuxI LuxCDABE
  • 22. AHL luxP(R) LuxR GFP (LVA) luxP(L) Weiss & Knight, 2000
  • 23. R0040 B0034 C0062 B0015 R0062 Canton et al., Nat Biotech, 2008
  • 24. BBa_F2620 PoPS 3OC6HSL Canton et al., Nat Biotech, 2008
  • 25. BBa_F2620 BBa_F2620 3OC6HSL PoPS Receiver Mechanism & Function Component Parts A transcription factor (LuxR) that is active in the presence of a cell-cell signaling molecule (3OC6HSL) is controlled by a regulated operator (PLtetO-1). Device input is 3OC6HSL. Device output is PoPS from a LuxR-regulated operator. If R0040 B0034 C0062 B0015 R0062 used in a cell containing TetR then a second input such as PLtetO-1 RBS luxR Term. Plux,R aTc can be used to produce a Boolean AND function. Static Performance* Dynamic Performance* http://parts.mit.edu/registry/index.php/Part:BBa_F2620 600 8 600 8 GFP synthesis rate (molecules cell−1 s−1) GFP synthesis rate (molecules cell−1 s−1) Population Mean Colony Range 7 + 3OC6HSL 7 500 Hill Equation 500 6 6 400 400 5 5 PoPS cell−1 PoPS cell−1 System 300 4 300 4 3 3 200 200 GFP synthesis rate (Low Input) 2 GFP synthesis rate (High Input) 2 100 100 Polynomial Fit (High Input) 1 PoPS (High Input) 1 Engineers 0 0 0 0 0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04 −10 0 10 20 30 40 50 [3OC6HSL] (M) Time (min) Pmax [3OC6HSL]n Pmax: 6.6 PoPS cell-1 BBa_F2620 Response Time: <1 min Pout = K: 1.5E-09 M 3OC6HSL BBa_T9002 Response Time: 6±1 min K n + [3OC6HSL]n n: 1.6 Inputs: 0 M (Low), 1E-07 M (High) 3OC6HSL Input Compatibility* Reliability** Device 600 8 C4HSL GFP synthesis rate (molecules cell−1 s−1) C6HSL 7 500 3OC6HSL 6 C7HSL 92 400 5 74 C8HSL gs PoPS cell−1 56 lin 3OC8HSL Engineers 300 4 38 92 ub 1E0 C10HSL Signaling Devices GFP 1E1 Do 20 (arb1E2 1E3 1E4 74 gs C12HSL 3 itrar 200 y un 56 lin its) ub 2 38 Low Input GFP1E0 1E1 Do (0 M 3OC6HSL) (arb 1E2 1E3 20 100 itrar 1 y un 1E4 its) High Input 0 0 (1E -7 M 3OC6HSL) 0E+00 1E−10 1E−09 1E−08 1E−07 1E−06 1E−05 1E−04 [AHL] (M) Genetic: >92/>56 culture doublings Part Compatibility (qualitative) Performance: >92/>56 culture doublings (low/high input during propagation) Chassis: MC4100, MG1655, and DH5 Plasmids: pSB3K3 and pSB1A2 Conditions (abridged) Devices: E0240, E0430 and E0434 Output: PoPS measured via BBa_E0240 Culture: Supplemented M9, 37ºC Transcriptional Output Demand (low/high input) Plasmid: pSB3K3 Nucleotides: 0 / 6xNt nucleotides cell-1 s-1 Chassis: MG1655 Polymerases: 0 / 1.5E-1xNt RNAP cell-1 *Equipment: PE Victor3 multi-well fluorimeter (Nt = downstream transcript length) **Equipment: BD FACScan cytometer Authors: Barry Canton Ania Labno Registry of Standard Biological Parts License: Public Updated: March 2008 making life better, one part at a time Canton et al., Nat Biotech, 2008
  • 26. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver Receiver Output Input
  • 27. Two-population cell-cell signaling Output pathway Quorum- Sender Sensing System Sender Receiver 8 Receiver Output Input System Engineers 7 Device Engineers BBa_F2620 PoPS 6 3OC6HSL R0040 B0034 C0062 B0015 R0062 5 AHL luxP(R) LuxR GFP (LVA) 4 luxP(L) Device Engineers 3 Biologists LuxR LuxI LuxCDABE 2 1
  • 29.
  • 31. Promoter reference BBa_J23101 tttacagctagctcagtcctaggtattatgctagc
  • 32. Measurement kit E X E0240 S P E. coli strain GFP reporter TOP10 pUC AmpR E X P1010 S P E X E0240 S P Medium copy Promoter reference BioBrick plasmid standard p15A KanR p15A KanR
  • 36. Promoter strength across laboratories MIT, Virginia Tech, Johns Hopkins, Berkeley, LBL, Harvard, Brown C.V.=0.113
  • 38. Lessons • Ad hoc reference standards are useful • Reference standards materials and instructions should be distributed • Standards enable comparison of parts • Standards help to identify sources of variability for part improvement
  • 39. Reuse
  • 40. The host cell is a chassis System Replication Transcription Translation Degradation Cellular Chassis
  • 41. A biological virtual machine System Virtual Machine Cellular Chassis
  • 42. System is coupled to the chassis a Ribosomes RNA Polymerases Chassis gene Engineered System b Ribosomes O-ribosomes
  • 43. Decouple system and chassis RNA Polymerases Chassis gene Engineered System b Ribosomes O-ribosomes T7 RNAP RNA Polymerases Chassis gene Engineered System
  • 44. Orthogonal transcription and translation (VM1) O-ribosome generator O-ribosome generator O-ribosomes mutated rrnB rrnB mutated PBAD Arabinose T7 generator RBS T7 RNAP T lacUV5 IPTG T7 RNAP
  • 45. GFP expression is specific 40E+4 VM1 + Reporter T7 RNAP + Reporter O-ribosomes + Reporter Fluorescence (Relative Units) VM1 30E+4 VM1 (Uninduced) 20E+4 10E+4 0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 Cell Density (OD600)
  • 46. VM1 consumes RNAP and ribosomes from the cell O-ribosome generator O-ribosome generator O-ribosomes mutated rrnB rrnB mutated PBAD Arabinose T7 generator RBS T7 RNAP T lacUV5 IPTG T7 RNAP
  • 47. Auto-regulating T7 RNAP and O-ribosomes (VM2.0) O-ribosome generator O-ribosomes mutated rrnB T7lacM T7 autogenerator (BBa_I20257) O-RBS lacI O-RBS T7 RNAP T LacI T7lacM T7 RNAP
  • 48. VM2.0 expresses GFP 1.2 Fluorescence/OD (Relative Units) 1 0.8 0.6 0.4 0.2 0 VM2.0 T7 RNAP O-ribosome VM2.0 + Generator + Generator + Reporter Reporter Reporter
  • 49. VM2.0 requires a lacIQ strain O-ribosome generator O-ribosomes mutated rrnB T7lacM T7 autogenerator (BBa_I20257) O-RBS lacI O-RBS T7 RNAP T LacI T7lacM T7 RNAP
  • 50. O-ribo Redesigned T7 autogenerator mutated rrnB T7lacM for increased lacI expression o-ribosome autogenerator (BBa_I20257) T7 generator o-ribo T7 autogenerator mutated rrnBO-RBS O-RBS lacI T7 RNAP T T7lacM (VM2.0) T7lacM T7 T7 autogenerator T7 autogenerator o-RBS T7 RNAP T o-RBS lacI T (VM2.2) T7lacM T7
  • 51. VM2.2 works in E. coli TOP10 2.0E+4 VM2.2 + Reporter T7 RNAP Autogenerator + Reporter O-ribosome Generator + Reporter Fluorescence (Relative Units) 1.6E+4 Reporter VM2.2 1.2E+4 0.8E+4 0.4E+4 0E+4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Cell Density (OD600)
  • 52. VM2.2 is less active than VM1 12E+4 12E+4 VM1.2 + Reporter VM2.2 + Reporter T7 RNAP + Reporter T7 RNAP Autogenerator + Reporter 10E+4 O-ribosomes + Reporter 10E+4 O-ribosome Generator + Reporter Fluorescence (Relative Units) Reporter Reporter VM1.2 VM2.2 8E+4 8E+4 6E+4 6E+4 4E+4 4E+4 2E+4 2E+4 0E+4 0E+4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Cell Density (OD600) Cell Density (OD600) O-ribosome generator o-ribosome generator O-ribosome generator O-ribosomes o-ribosomes mutated rrnB rrnB mutated mutated rrnB PBAD T7lacM Arabinose T7 autogenerator T7 generator LacI o-RBS T7 RNAP T o-RBS lacI T RBS T7 RNAP T T7lacM lacUV5 IPTG T7 RNAP T7 RNAP
  • 53. Standardization Refinement Measurement Reuse
  • 54. Constructive synthetic biology Make it fun Make it safe Make it open
  • 55.
  • 56. iGEM is a proof-of-concept
  • 57.